View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15465_low_100 (Length: 244)
Name: NF15465_low_100
Description: NF15465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15465_low_100 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 96 - 230
Target Start/End: Complemental strand, 5440126 - 5439992
Alignment:
| Q |
96 |
ggaaatggtataagtaaatgtgcttttctaccttgaccctagatttctaaacattgcaaagggaaataagagagcatgttaaaaagtgcatgttgctagc |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5440126 |
ggaaatggtataagtaaatgtgcttttctaccttgaccctagatttctaaacattgcaaagggaaataagagagcatgttgaaaagtgcatgttgctagc |
5440027 |
T |
 |
| Q |
196 |
attattcgactcaataaaatgtccatttattttat |
230 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |
|
|
| T |
5440026 |
attattcaactcaataaaatgtccatttattttat |
5439992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 7 - 43
Target Start/End: Complemental strand, 5440168 - 5440132
Alignment:
| Q |
7 |
tagtggaaatatcaaatgacatatatgatatatgcat |
43 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5440168 |
tagtggaaatatcaaatgacatatatgatatatgcat |
5440132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University