View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15465_low_102 (Length: 242)
Name: NF15465_low_102
Description: NF15465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15465_low_102 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 164
Target Start/End: Complemental strand, 3236915 - 3236751
Alignment:
| Q |
1 |
aaaaatggcatctttaagagatgggtttgtgaaataacaagatttaggagatttgagatgaggaagatgatttggggattgagaatggagggaggtaaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3236915 |
aaaaatggcatctttaagagatgggtttgtgaaataacaagatttaggagatttgagatgaggaagatgatttggggattgagaatggagggaggtaaca |
3236816 |
T |
|
| Q |
101 |
gacctcagaatctgtcacagaagtaaa-aaagcttataaaaatcagaatcatacaatgcaatgct |
164 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3236815 |
gacctcagaatctgtcacagaagtaaataaagcttataaaaatcagaatcatacaatgcaatgct |
3236751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 188 - 235
Target Start/End: Complemental strand, 3236723 - 3236676
Alignment:
| Q |
188 |
tactgagcatgtcttgaagaacaggtttgggtttgttattgatgatgt |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3236723 |
tactgagcatgtcttgaagaacaggtttgggtttgttattgctgatgt |
3236676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University