View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15465_low_107 (Length: 239)
Name: NF15465_low_107
Description: NF15465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15465_low_107 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 10 - 239
Target Start/End: Complemental strand, 7885731 - 7885502
Alignment:
| Q |
10 |
attattctcttcatagtctaataaaaccatacttaatcttaattttacatccagtaatagattaagggttatcttaaggctaaaggtttaatcacaaaga |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7885731 |
attattctcttcatagtctaataaaaccatacttaatcttaattttacatccagtaatagattaagggttatcttaaggctaaaggtttaatcacaaaga |
7885632 |
T |
|
| Q |
110 |
aattaggactatacatcgtttaattggtaacgacataagaattaattcagtgtgtagagtccgataaatagtacatagttttcaagttatattcatccct |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
7885631 |
aattaggactatacatcgtttaattggtaacgacataagaattaattcagtgtgtagagtccgataaatagtacacagttttcaagtcatattcatccct |
7885532 |
T |
|
| Q |
210 |
ggcatttttattctaaataatttacaatca |
239 |
Q |
| |
|
| |||||||||||||||||||||||||||| |
|
|
| T |
7885531 |
gacatttttattctaaataatttacaatca |
7885502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University