View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15465_low_111 (Length: 230)
Name: NF15465_low_111
Description: NF15465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15465_low_111 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 53; Significance: 1e-21; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 167 - 230
Target Start/End: Original strand, 43287723 - 43287787
Alignment:
| Q |
167 |
attagacaaccttttttatt-ataataaaatttattttcttattaaaaataatatgagcacactc |
230 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43287723 |
attagacaaccttttttatttataataaaatttattttcttatgaaaaataatatgagcacactc |
43287787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 43287548 - 43287614
Alignment:
| Q |
1 |
ggttcaaaattcagtccc-gcatgttttatccttgcaactagcacctaagatgtatttacaagatag |
66 |
Q |
| |
|
||||| ||||||||| || ||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
43287548 |
ggttcgaaattcagttcctgcatgttttatccttgcaattagcacctaagatgtatttacaagatag |
43287614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University