View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15465_low_114 (Length: 222)
Name: NF15465_low_114
Description: NF15465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15465_low_114 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 148; Significance: 3e-78; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 16 - 175
Target Start/End: Original strand, 33742047 - 33742206
Alignment:
| Q |
16 |
agagacaggaaaaagaattgttcgccgctgcgctagaaagtatttccgcgtgctcttattttctctttagggaatgtagatttcctctgtttacagctat |
115 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33742047 |
agagacaggaaaaagaattgctcgccgctgcgctagaaagtatttccgcgtgctcttattttctctttagggaatgtagatttcctctgtttacagctat |
33742146 |
T |
|
| Q |
116 |
taatttttacttttctcaaaagtgcttttaggggatgattttgagagtgaatcctctaaa |
175 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33742147 |
taattcttacttttctcaaaagtgcttttaggggacgattttgagagtgaatcctctaaa |
33742206 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 48 - 153
Target Start/End: Original strand, 33729564 - 33729669
Alignment:
| Q |
48 |
ctagaaagtatttccgcgtgctcttattt-tctctttagggaatgtagatttcctctgtttacagctattaatttttacttttctcaaaagtgcttttag |
146 |
Q |
| |
|
|||||||||| | |||| ||||||||||| ||||| |||||| | |||||||||| |||| |||||||||||| | | ||||||||||| || ||| || |
|
|
| T |
33729564 |
ctagaaagtaatgccgcttgctcttatttctctctctaggga-tctagatttccttagttttcagctattaattctcaattttctcaaaaatgatttcag |
33729662 |
T |
|
| Q |
147 |
gggatga |
153 |
Q |
| |
|
||||||| |
|
|
| T |
33729663 |
gggatga |
33729669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University