View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15465_low_115 (Length: 222)
Name: NF15465_low_115
Description: NF15465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15465_low_115 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 2 - 212
Target Start/End: Complemental strand, 42442576 - 42442366
Alignment:
| Q |
2 |
caacctgatacccctttgcttcgtttagcttggaacgagaaggatttgaggtatatggccactattttgatggatagtaataaagttgtgattttggata |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42442576 |
caacctgatacccctttgcttcgtttagcttggaacaagaaggatttgaggtatatggccacgattttgatggatagtaataaagttgtgattttggata |
42442477 |
T |
|
| Q |
102 |
ttagatcaccaactacaccggtcgcagaattggagagacattgcgctggtgttaatgctattgcttgggctccaagaagttcaaagcatatttgttctgg |
201 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
42442476 |
ttagatcaccaactacaccggtcgcggaattggagagacatcgcgctggtgttaatgctattgcttgggctccaagaagttcaaagcatatttgttccgg |
42442377 |
T |
|
| Q |
202 |
tggggatgatg |
212 |
Q |
| |
|
||||||||||| |
|
|
| T |
42442376 |
tggggatgatg |
42442366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 128 - 212
Target Start/End: Complemental strand, 42439098 - 42439014
Alignment:
| Q |
128 |
gaattggagagacattgcgctggtgttaatgctattgcttgggctccaagaagttcaaagcatatttgttctggtggggatgatg |
212 |
Q |
| |
|
||||||||||||||| ||||| ||| |||| |||| ||||||||||||| ||| |||||||||||||| ||||||||||||| |
|
|
| T |
42439098 |
gaattggagagacatcacgctgatgtcaatgtgattgtttgggctccaagatgtttgaagcatatttgttcgggtggggatgatg |
42439014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University