View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15465_low_117 (Length: 203)
Name: NF15465_low_117
Description: NF15465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15465_low_117 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 16 - 185
Target Start/End: Original strand, 25393598 - 25393767
Alignment:
| Q |
16 |
agatgaagaggaagacatgagggaagctttcaatgtctttgatcaaaatggtgacggttttataaccgtcgaggaactgagagtggttttgtcatctctt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25393598 |
agatgaagaggaagacatgagggaagctttcaatgtctttgatcaaaatggtgacggttttataaccgtcgaggaactgagagtggttttgtcatctctt |
25393697 |
T |
|
| Q |
116 |
ggtcttaaacaaggaagaaccgtcgaggaatgtaagaggatgattatgaaggtggatgttgatggtgatg |
185 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25393698 |
ggtcttaaacaaggaagaaccgttgaggaatgtaagaggatgattatgaaggtggatgttgatggtgatg |
25393767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University