View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15465_low_51 (Length: 378)
Name: NF15465_low_51
Description: NF15465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15465_low_51 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 18 - 230
Target Start/End: Original strand, 3016074 - 3016286
Alignment:
| Q |
18 |
gtttacttacaatggtagaagaatattaatatgtaagatcttaaaaatgataatctaactctaagacaatcacaaaatgctgacaaatccatcatctatg |
117 |
Q |
| |
|
|||||||||||| |||||| ||||||| ||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3016074 |
gtttacttacaacggtagacgaatattgatatgtatgatcttaaaaatgataatctaactctaagacaatcataaaatgctgacaaatccatcatctatg |
3016173 |
T |
 |
| Q |
118 |
ataaacacggtatacttacgacacatttttaatgacacgatgttgaataagtgtcaaagaatttgtatctataacatagttataaacaaaaaattataca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3016174 |
ataaacacggtatacttacgacacatttttaatgacacgatgttgaataagtgtcaaagaatttgtatctataacatagttataaacaaaaaattataca |
3016273 |
T |
 |
| Q |
218 |
aatttgagtatat |
230 |
Q |
| |
|
||||||||||||| |
|
|
| T |
3016274 |
aatttgagtatat |
3016286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 322 - 368
Target Start/End: Original strand, 3016388 - 3016434
Alignment:
| Q |
322 |
ttcgtaaatgtttacgcaattgaacctaatttacttcacatttcatc |
368 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3016388 |
ttcgtaaatgtttacgcaattgaacctaatttacttcacatttcatc |
3016434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University