View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15465_low_56 (Length: 350)
Name: NF15465_low_56
Description: NF15465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15465_low_56 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 136; Significance: 7e-71; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 136; E-Value: 7e-71
Query Start/End: Original strand, 161 - 334
Target Start/End: Original strand, 48829450 - 48829627
Alignment:
| Q |
161 |
ctttatgaaaataatttctcaagaattccttgtgagat-gattcatatttagagggatgcaataggaatttgtgaggctcttttctcatccaaaggtttg |
259 |
Q |
| |
|
|||| |||||||| |||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48829450 |
ctttctgaaaatactttctccagaattccttgtgagattgattcatatttagagggatgcaataggaatttgtgaggctcttttctcatccaaaggtttg |
48829549 |
T |
|
| Q |
260 |
gggggattttcttg---aaaataaaaactgatggaatttgaaggtgatcatagcgataaaagaatcttgggttaatgt |
334 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
48829550 |
ggggaattttcttgaaaaaaataaaaactgatggaatttgaaggtgatcatagcggtaaaagaatcttgggttaatgt |
48829627 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 99; E-Value: 8e-49
Query Start/End: Original strand, 15 - 124
Target Start/End: Original strand, 48829303 - 48829413
Alignment:
| Q |
15 |
gaatcataacacatttttgcactattttcagcatatatttgtgttcaaacgcatatagtataaatagaactcactctcgtta-tttcattcaattgacac |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
48829303 |
gaatcataacacatttttgcactattttcagcatatatttgtgttcaaacgcatatagtataaatagaactcactctcggtattttcattcaattgacac |
48829402 |
T |
|
| Q |
114 |
attcattcatc |
124 |
Q |
| |
|
||||||||||| |
|
|
| T |
48829403 |
attcattcatc |
48829413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University