View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15465_low_72 (Length: 298)
Name: NF15465_low_72
Description: NF15465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15465_low_72 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 15 - 298
Target Start/End: Complemental strand, 43595975 - 43595692
Alignment:
| Q |
15 |
aatgtatattgttgggcttaaaacattcactgcagaaggaattgtagcaaaaagatttaaaatagaagacttgcctcgtgtataagaactgttgcatctc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43595975 |
aatgtatattgttgggcttaaaacattcactgcagaaggaattgtagcaaaaagatttaaaatagaagacttgcctcgtgtataagaactgttgcatctc |
43595876 |
T |
 |
| Q |
115 |
gagatgcttttattagctctgggcaaggccttgtgtcaccagaatatacaatcttccaaccaggtatcacttttccaacactattaatcctcttttctgc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43595875 |
gagatgcttttattagctctgggcaaggccttgtgtcaccagaatatacaatcttccaaccaggtatcacttttccaacactattaatcctcttttctgc |
43595776 |
T |
 |
| Q |
215 |
ttctagaacaacaccatatgactgtgagcaatgtacaacgggaaaactaatcaaagtattgagaccagcttcctggattacccc |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43595775 |
ttctagaacaacaccatatgactgtgagcaatgtacaacgggaaaactaatcaaagtattgagaccagcttcctggattacccc |
43595692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University