View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15465_low_75 (Length: 290)
Name: NF15465_low_75
Description: NF15465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15465_low_75 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 16 - 250
Target Start/End: Complemental strand, 53292 - 53058
Alignment:
| Q |
16 |
attaaccagactccacacccgccatgttttcacaatacgttcacccacctctaattaattatgtatgattgtttgctaaaatattcggaaatcttcgcat |
115 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53292 |
attaaccagactccacacccgctatgttttcacaataagttcacccacctctaattaattatgtatgattgtttgctaaaatattcggaaatcttcgcat |
53193 |
T |
|
| Q |
116 |
tgaaccaaagacaatcaaacaaacgacttagacaatacatcttcatcaaaaatcttaatgtgttgtgctgggtatatgtgccttctcgattatatgttat |
215 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53192 |
tgaaccaaagataatcaaacaaacgacttacacaatacatcttcatcaaaaatcttaatatgttgtgctgggtatatgtgccttctcgattatatgttat |
53093 |
T |
|
| Q |
216 |
tcaacatttatgctattaatggacttgatacacca |
250 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||| |
|
|
| T |
53092 |
tcagcatttatgctattaatggacttgatacacca |
53058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University