View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15466_high_2 (Length: 224)
Name: NF15466_high_2
Description: NF15466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15466_high_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 18 - 199
Target Start/End: Complemental strand, 527431 - 527249
Alignment:
| Q |
18 |
atacatgtagttagttggtcaaaattaccttgagtgaagtgcgcctgttctgaaaccaaaacttgatttgcgttgggtctaacccagtccgaaggctcag |
117 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
527431 |
atacatgtagttagttggtcaaagttaccttcagtgaagtgcgcctgttctgaaaccaaaacttgatttgcgttgggtctaacccagtccgaaggctcag |
527332 |
T |
 |
| Q |
118 |
ctctcttctctgagcatcattaggattaggacactgcttgaagaaactgatgac-aaaaccaagttcaaaaaatatggagcaa |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
527331 |
ctctcttctctgagcatcattaggattaggacactgcttgaagaagctgatgacaaaaaccaagttcaaaaaatatggagcaa |
527249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University