View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15468_high_8 (Length: 336)
Name: NF15468_high_8
Description: NF15468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15468_high_8 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 64 - 336
Target Start/End: Original strand, 4985817 - 4986089
Alignment:
| Q |
64 |
ctgagaagatattttattcttgattgtgtatcaaaatttgtttaaattgcggcacaaactcttgtaattttaatgtaaatatagggcactacttgccgac |
163 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4985817 |
ctgagaagatattttattcttgattgtatatcaaaatttgtttaaattgcggcacaaactcttgtaattttaatgtaaatataggacactacttgccgaa |
4985916 |
T |
|
| Q |
164 |
agttgaaaattttgagctccaaagtctcaatcaaatttcaaacctaactgttgacaatgaactttgtaggtgagattccttgagattatggcaactgtta |
263 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
4985917 |
agtagaaaattttgagctccaaagtctcaatcaaatttcaaacctaactgttgacaatgaactttgtcggtgagattccttgagattatggcaactgtta |
4986016 |
T |
|
| Q |
264 |
tgtcataaaaaaggtttnnnnnnntaacagtctcatttttaaggttagtgtgtcttaccatatttttgcatga |
336 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4986017 |
tgtcataaaaaaggtttaaaaaaataacagtctcatttttaaggttagtgtgtcttaccatatttttgcatga |
4986089 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University