View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15468_low_2 (Length: 306)
Name: NF15468_low_2
Description: NF15468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15468_low_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 88; Significance: 3e-42; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 152 - 239
Target Start/End: Complemental strand, 1846328 - 1846241
Alignment:
| Q |
152 |
agaatgagaaggatgattgatgactaaccccagagtctcattgttaatgtcaactaggaattatgtatttttagaccaagagagattt |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1846328 |
agaatgagaaggatgattgatgactaaccccagagtctcattgttaatgtcaactaggaattatgtatttttagaccaagagagattt |
1846241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 250 - 289
Target Start/End: Complemental strand, 1846202 - 1846163
Alignment:
| Q |
250 |
ggggctacaagtgtgaacactgaccatgttagaagttagt |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1846202 |
ggggctacaagtgtgaacactgaccatgttagaagttagt |
1846163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University