View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1546_high_2 (Length: 383)

Name: NF1546_high_2
Description: NF1546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1546_high_2
NF1546_high_2
[»] scaffold0064 (1 HSPs)
scaffold0064 (3-264)||(54312-54573)
[»] chr1 (33 HSPs)
chr1 (89-264)||(16858357-16858535)
chr1 (185-339)||(48471887-48472041)
chr1 (182-295)||(24962076-24962188)
chr1 (182-297)||(19077992-19078106)
chr1 (182-297)||(19125882-19125996)
chr1 (182-297)||(24196384-24196498)
chr1 (182-295)||(3616922-3617034)
chr1 (151-255)||(18106817-18106922)
chr1 (185-294)||(29676205-29676313)
chr1 (196-295)||(4059591-4059690)
chr1 (182-295)||(24749921-24750033)
chr1 (196-297)||(27092919-27093020)
chr1 (151-264)||(23279692-23279807)
chr1 (186-264)||(16551743-16551821)
chr1 (187-280)||(28920740-28920833)
chr1 (182-295)||(43706723-43706835)
chr1 (182-295)||(46432285-46432397)
chr1 (182-264)||(29182100-29182182)
chr1 (182-339)||(2425346-2425503)
chr1 (184-272)||(2657605-2657692)
chr1 (182-264)||(2260478-2260560)
chr1 (202-295)||(51719191-51719284)
chr1 (182-264)||(4455142-4455224)
chr1 (194-272)||(9554293-9554371)
chr1 (186-272)||(31084704-31084789)
chr1 (196-262)||(47685237-47685303)
chr1 (179-262)||(28552417-28552502)
chr1 (185-264)||(22786155-22786231)
chr1 (177-261)||(27495107-27495192)
chr1 (234-272)||(21148121-21148159)
chr1 (186-264)||(21185330-21185407)
chr1 (179-267)||(6285272-6285361)
chr1 (182-259)||(9387816-9387893)
[»] chr5 (41 HSPs)
chr5 (182-339)||(18695126-18695282)
chr5 (182-297)||(245717-245831)
chr5 (182-339)||(26639061-26639218)
chr5 (182-339)||(25556900-25557056)
chr5 (151-264)||(20732631-20732744)
chr5 (182-297)||(16901064-16901178)
chr5 (182-297)||(40428706-40428820)
chr5 (152-264)||(18739807-18739920)
chr5 (182-297)||(19169466-19169580)
chr5 (151-264)||(38545376-38545490)
chr5 (151-252)||(16287577-16287678)
chr5 (204-339)||(16307501-16307636)
chr5 (151-264)||(38322291-38322405)
chr5 (185-262)||(17825599-17825676)
chr5 (182-264)||(38476570-38476651)
chr5 (177-274)||(8673947-8674043)
chr5 (182-295)||(31055383-31055495)
chr5 (182-293)||(36641266-36641376)
chr5 (196-339)||(7835845-7835988)
chr5 (182-295)||(10379404-10379516)
chr5 (182-286)||(37961326-37961430)
chr5 (151-256)||(42757550-42757657)
chr5 (185-272)||(462891-462978)
chr5 (182-280)||(38408751-38408848)
chr5 (151-255)||(26214094-26214199)
chr5 (215-262)||(41663625-41663672)
chr5 (182-276)||(10293175-10293268)
chr5 (182-255)||(23040057-23040130)
chr5 (186-267)||(35302011-35302092)
chr5 (182-262)||(2373267-2373347)
chr5 (89-137)||(3023751-3023799)
chr5 (209-264)||(23765492-23765545)
chr5 (209-264)||(23815340-23815393)
chr5 (186-294)||(34125186-34125294)
chr5 (182-264)||(17704687-17704768)
chr5 (211-260)||(7187340-7187388)
chr5 (179-264)||(36954471-36954556)
chr5 (198-273)||(28538502-28538577)
chr5 (90-132)||(16287743-16287785)
chr5 (203-264)||(15885265-15885326)
chr5 (179-235)||(24025171-24025227)
[»] chr7 (64 HSPs)
chr7 (151-264)||(38722903-38723017)
chr7 (182-339)||(24597541-24597696)
chr7 (182-296)||(3562501-3562614)
chr7 (186-339)||(31494037-31494190)
chr7 (182-339)||(27869220-27869376)
chr7 (182-339)||(19195238-19195394)
chr7 (97-267)||(14196920-14197092)
chr7 (182-297)||(20636742-20636855)
chr7 (151-267)||(9154395-9154512)
chr7 (182-295)||(21224421-21224533)
chr7 (182-295)||(35337591-35337703)
chr7 (185-294)||(36746573-36746681)
chr7 (182-295)||(41452318-41452430)
chr7 (182-339)||(13577811-13577967)
chr7 (182-294)||(42271455-42271566)
chr7 (179-294)||(6650629-6650744)
chr7 (89-262)||(46267348-46267521)
chr7 (186-339)||(11843202-11843355)
chr7 (182-335)||(8526919-8527070)
chr7 (182-280)||(2331136-2331233)
chr7 (182-264)||(15681752-15681834)
chr7 (151-264)||(24730822-24730936)
chr7 (151-267)||(45782119-45782237)
chr7 (181-294)||(5087117-5087230)
chr7 (196-297)||(19919670-19919771)
chr7 (182-267)||(23439716-23439801)
chr7 (179-260)||(47113234-47113315)
chr7 (182-295)||(48176032-48176144)
chr7 (182-273)||(39440211-39440302)
chr7 (182-292)||(21225621-21225729)
chr7 (182-294)||(17305887-17305999)
chr7 (182-294)||(9822170-9822281)
chr7 (182-294)||(10724095-10724206)
chr7 (185-260)||(4193675-4193750)
chr7 (182-264)||(14624725-14624806)
chr7 (182-264)||(39182056-39182138)
chr7 (202-295)||(10655471-10655564)
chr7 (182-267)||(23473112-23473197)
chr7 (182-251)||(26126376-26126445)
chr7 (177-264)||(5348144-5348232)
chr7 (196-264)||(10023885-10023952)
chr7 (185-267)||(23461118-23461200)
chr7 (182-284)||(24464698-24464800)
chr7 (184-272)||(3148048-3148135)
chr7 (182-280)||(43251387-43251486)
chr7 (182-244)||(5111561-5111623)
chr7 (182-264)||(42303269-42303350)
chr7 (182-246)||(4571461-4571525)
chr7 (216-280)||(33237497-33237561)
chr7 (225-264)||(1921040-1921079)
chr7 (182-297)||(7365345-7365460)
chr7 (185-260)||(26385386-26385461)
chr7 (182-264)||(3403151-3403233)
chr7 (182-280)||(18754350-18754447)
chr7 (182-232)||(20638614-20638663)
chr7 (226-295)||(19493484-19493553)
chr7 (196-292)||(44077942-44078039)
chr7 (184-267)||(23373487-23373571)
chr7 (182-268)||(5776874-5776961)
chr7 (182-264)||(24448142-24448225)
chr7 (162-255)||(35533496-35533592)
chr7 (94-141)||(46267256-46267303)
chr7 (184-258)||(25002831-25002905)
chr7 (89-137)||(9154302-9154350)
[»] chr4 (48 HSPs)
chr4 (182-295)||(13397744-13397856)
chr4 (178-295)||(25618697-25618813)
chr4 (182-335)||(4357375-4357527)
chr4 (182-339)||(13826444-13826600)
chr4 (182-339)||(15058844-15058999)
chr4 (151-262)||(14612239-14612351)
chr4 (186-297)||(5304414-5304524)
chr4 (182-280)||(35475412-35475509)
chr4 (183-264)||(2715817-2715897)
chr4 (182-297)||(27018337-27018451)
chr4 (151-264)||(33978822-33978936)
chr4 (151-264)||(32335915-32336029)
chr4 (182-264)||(51291269-51291351)
chr4 (182-263)||(4098779-4098860)
chr4 (196-297)||(6789025-6789126)
chr4 (152-264)||(7540189-7540302)
chr4 (202-295)||(19232412-19232505)
chr4 (182-263)||(41034759-41034839)
chr4 (177-293)||(36729159-36729275)
chr4 (182-297)||(43793698-43793812)
chr4 (160-262)||(47645516-47645619)
chr4 (216-335)||(47869811-47869929)
chr4 (183-264)||(52838352-52838431)
chr4 (152-256)||(40259673-40259778)
chr4 (152-255)||(14784668-14784771)
chr4 (209-265)||(23362580-23362636)
chr4 (182-293)||(41877099-41877207)
chr4 (184-272)||(45633561-45633648)
chr4 (196-295)||(25011871-25011970)
chr4 (182-272)||(1588506-1588594)
chr4 (232-294)||(13394606-13394668)
chr4 (179-264)||(16291780-16291866)
chr4 (184-264)||(2931446-2931524)
chr4 (196-260)||(55780522-55780586)
chr4 (196-260)||(55844702-55844766)
chr4 (177-272)||(14804436-14804531)
chr4 (182-255)||(9195773-9195845)
chr4 (196-260)||(4433287-4433351)
chr4 (179-264)||(14857450-14857536)
chr4 (182-272)||(24626312-24626402)
chr4 (179-272)||(12101218-12101311)
chr4 (211-264)||(15734549-15734602)
chr4 (89-137)||(14612141-14612189)
chr4 (209-264)||(15795466-15795521)
chr4 (202-272)||(22057350-22057421)
chr4 (184-253)||(5931971-5932041)
chr4 (182-264)||(6209339-6209423)
chr4 (209-268)||(43336035-43336095)
[»] chr8 (35 HSPs)
chr8 (182-331)||(4518901-4519048)
chr8 (182-297)||(38630178-38630292)
chr8 (182-295)||(19391456-19391568)
chr8 (196-297)||(8802467-8802568)
chr8 (182-339)||(5192296-5192452)
chr8 (182-297)||(18881570-18881685)
chr8 (182-264)||(4807700-4807781)
chr8 (182-264)||(19924388-19924469)
chr8 (182-280)||(17648366-17648463)
chr8 (202-294)||(7117184-7117276)
chr8 (182-297)||(30784332-30784445)
chr8 (182-345)||(44147094-44147256)
chr8 (182-295)||(12723330-12723442)
chr8 (177-294)||(23565207-23565323)
chr8 (182-297)||(21666341-21666455)
chr8 (182-264)||(22452273-22452354)
chr8 (153-240)||(32731372-32731460)
chr8 (182-264)||(3208102-3208184)
chr8 (182-264)||(18252986-18253068)
chr8 (202-295)||(33895516-33895608)
chr8 (182-339)||(32400348-32400503)
chr8 (185-280)||(15869422-15869517)
chr8 (179-264)||(16233576-16233662)
chr8 (151-267)||(132473-132589)
chr8 (182-294)||(4423100-4423211)
chr8 (89-264)||(8137544-8137718)
chr8 (182-276)||(41385578-41385672)
chr8 (166-256)||(30199469-30199560)
chr8 (239-295)||(21929916-21929972)
chr8 (187-294)||(31268405-31268513)
chr8 (215-272)||(1824760-1824816)
chr8 (215-272)||(1859205-1859261)
chr8 (89-137)||(30199615-30199663)
chr8 (89-141)||(32731461-32731513)
chr8 (196-264)||(41688210-41688278)
[»] chr3 (47 HSPs)
chr3 (182-339)||(48907317-48907473)
chr3 (182-297)||(4522077-4522191)
chr3 (182-297)||(26628092-26628206)
chr3 (182-295)||(3328882-3328994)
chr3 (182-339)||(13081017-13081174)
chr3 (185-297)||(8339007-8339118)
chr3 (182-339)||(27852777-27852932)
chr3 (177-280)||(3820999-3821102)
chr3 (182-339)||(8542733-8542890)
chr3 (182-297)||(28154949-28155063)
chr3 (177-339)||(32960669-32960828)
chr3 (186-294)||(22416460-22416568)
chr3 (182-295)||(6927593-6927705)
chr3 (182-339)||(22500620-22500776)
chr3 (196-339)||(25179714-25179855)
chr3 (182-280)||(3781001-3781098)
chr3 (108-264)||(24312763-24312922)
chr3 (182-294)||(30155215-30155326)
chr3 (203-345)||(25022682-25022824)
chr3 (183-264)||(26127006-26127086)
chr3 (161-264)||(32463519-32463623)
chr3 (209-295)||(22447809-22447895)
chr3 (182-280)||(23428703-23428800)
chr3 (182-264)||(34878629-34878710)
chr3 (182-295)||(28173798-28173910)
chr3 (180-267)||(2683068-2683156)
chr3 (196-255)||(26633468-26633527)
chr3 (182-280)||(20001832-20001929)
chr3 (151-264)||(48743231-48743347)
chr3 (182-295)||(10743530-10743642)
chr3 (183-264)||(26177056-26177136)
chr3 (216-264)||(40836278-40836326)
chr3 (182-264)||(33279685-33279766)
chr3 (198-264)||(43668566-43668632)
chr3 (196-295)||(46673116-46673216)
chr3 (209-272)||(20626814-20626877)
chr3 (182-297)||(36311273-36311388)
chr3 (184-280)||(35201079-35201175)
chr3 (184-295)||(1743373-1743484)
chr3 (185-280)||(33105066-33105161)
chr3 (211-273)||(36033738-36033800)
chr3 (202-264)||(46387681-46387743)
chr3 (182-262)||(48860825-48860905)
chr3 (180-263)||(9662347-9662431)
chr3 (216-264)||(31039077-31039125)
chr3 (215-294)||(23320516-23320594)
chr3 (179-273)||(25310191-25310286)
[»] chr6 (36 HSPs)
chr6 (182-297)||(18791480-18791594)
chr6 (182-297)||(35102558-35102672)
chr6 (177-264)||(20863828-20863915)
chr6 (182-284)||(24603484-24603585)
chr6 (182-294)||(32451849-32451960)
chr6 (182-297)||(31210917-31211031)
chr6 (182-264)||(25819807-25819888)
chr6 (196-284)||(26710387-26710475)
chr6 (182-339)||(34834048-34834204)
chr6 (177-264)||(23124820-23124907)
chr6 (182-272)||(22269529-22269618)
chr6 (182-295)||(14572247-14572359)
chr6 (196-297)||(24051144-24051245)
chr6 (182-294)||(4597475-4597586)
chr6 (179-272)||(11661011-11661105)
chr6 (182-295)||(18749165-18749277)
chr6 (182-254)||(8412881-8412952)
chr6 (151-267)||(19176468-19176584)
chr6 (182-297)||(12291484-12291599)
chr6 (182-264)||(9241774-9241856)
chr6 (203-297)||(15298628-15298721)
chr6 (182-272)||(26240079-26240169)
chr6 (182-294)||(3118802-3118913)
chr6 (186-294)||(2636903-2637012)
chr6 (185-294)||(34528273-34528382)
chr6 (182-232)||(14195682-14195732)
chr6 (182-239)||(4013791-4013848)
chr6 (182-227)||(4371020-4371065)
chr6 (182-242)||(19282333-19282392)
chr6 (185-264)||(24615793-24615872)
chr6 (185-264)||(29365416-29365496)
chr6 (203-294)||(22968226-22968316)
chr6 (203-294)||(23820077-23820167)
chr6 (177-263)||(24084984-24085071)
chr6 (179-232)||(9620538-9620591)
chr6 (196-264)||(12293713-12293782)
[»] chr2 (36 HSPs)
chr2 (182-297)||(15735187-15735301)
chr2 (182-339)||(2986809-2986966)
chr2 (182-295)||(17368339-17368451)
chr2 (182-339)||(9787682-9787837)
chr2 (182-297)||(11176030-11176144)
chr2 (180-295)||(18537897-18538011)
chr2 (185-295)||(38716319-38716428)
chr2 (203-295)||(25298870-25298962)
chr2 (182-339)||(30714299-30714455)
chr2 (89-267)||(19618870-19619049)
chr2 (89-267)||(22698944-22699124)
chr2 (151-267)||(35844808-35844925)
chr2 (151-264)||(11919737-11919851)
chr2 (186-297)||(6763784-6763894)
chr2 (182-297)||(9051095-9051208)
chr2 (177-255)||(15147830-15147908)
chr2 (182-296)||(22191169-22191281)
chr2 (182-295)||(15700870-15700982)
chr2 (182-264)||(4104924-4105006)
chr2 (151-267)||(9775458-9775575)
chr2 (185-264)||(14743443-14743522)
chr2 (151-267)||(28319103-28319219)
chr2 (186-264)||(2190659-2190737)
chr2 (182-264)||(28365632-28365714)
chr2 (182-272)||(26829181-26829271)
chr2 (179-264)||(2123494-2123580)
chr2 (179-267)||(74943-75031)
chr2 (196-264)||(22387167-22387236)
chr2 (182-294)||(36464395-36464506)
chr2 (179-264)||(33199572-33199658)
chr2 (151-267)||(35935436-35935554)
chr2 (182-263)||(331835-331916)
chr2 (199-272)||(21773423-21773496)
chr2 (89-137)||(25547803-25547851)
chr2 (202-241)||(4588003-4588042)
chr2 (182-248)||(25884293-25884359)
[»] scaffold0419 (1 HSPs)
scaffold0419 (182-339)||(2985-3141)
[»] scaffold0025 (2 HSPs)
scaffold0025 (182-297)||(19405-19519)
scaffold0025 (182-295)||(61937-62051)
[»] scaffold0005 (4 HSPs)
scaffold0005 (151-262)||(205026-205138)
scaffold0005 (152-255)||(54959-55062)
scaffold0005 (177-272)||(35196-35291)
scaffold0005 (89-137)||(205188-205236)
[»] scaffold0607 (1 HSPs)
scaffold0607 (182-295)||(2118-2230)
[»] scaffold1875 (1 HSPs)
scaffold1875 (186-297)||(823-934)
[»] scaffold0007 (1 HSPs)
scaffold0007 (182-297)||(250585-250699)
[»] scaffold0406 (1 HSPs)
scaffold0406 (182-295)||(2114-2226)
[»] scaffold0179 (1 HSPs)
scaffold0179 (182-297)||(5717-5830)
[»] scaffold0087 (1 HSPs)
scaffold0087 (182-297)||(25031-25145)
[»] scaffold0001 (1 HSPs)
scaffold0001 (182-295)||(142016-142128)
[»] scaffold0150 (1 HSPs)
scaffold0150 (182-339)||(5955-6110)
[»] scaffold0267 (1 HSPs)
scaffold0267 (182-280)||(3652-3749)
[»] scaffold0062 (2 HSPs)
scaffold0062 (182-295)||(49782-49894)
scaffold0062 (182-295)||(62321-62433)
[»] scaffold0060 (1 HSPs)
scaffold0060 (182-295)||(66297-66409)
[»] scaffold0173 (1 HSPs)
scaffold0173 (89-255)||(22814-22983)
[»] scaffold0002 (1 HSPs)
scaffold0002 (182-280)||(455149-455247)
[»] scaffold0291 (1 HSPs)
scaffold0291 (186-294)||(10047-10155)
[»] scaffold0084 (1 HSPs)
scaffold0084 (179-267)||(4613-4701)
[»] scaffold0024 (1 HSPs)
scaffold0024 (182-264)||(43924-44006)
[»] scaffold0014 (1 HSPs)
scaffold0014 (182-276)||(112249-112343)
[»] scaffold0683 (1 HSPs)
scaffold0683 (224-297)||(5188-5261)
[»] scaffold0010 (1 HSPs)
scaffold0010 (151-267)||(128448-128563)
[»] scaffold0474 (1 HSPs)
scaffold0474 (215-277)||(8067-8129)
[»] scaffold0174 (1 HSPs)
scaffold0174 (182-295)||(29838-29951)
[»] scaffold0171 (1 HSPs)
scaffold0171 (194-262)||(9166-9235)
[»] scaffold0103 (1 HSPs)
scaffold0103 (186-294)||(2997-3106)
[»] scaffold1202 (1 HSPs)
scaffold1202 (182-232)||(1906-1955)


Alignment Details
Target: scaffold0064 (Bit Score: 168; Significance: 6e-90; HSPs: 1)
Name: scaffold0064
Description:

Target: scaffold0064; HSP #1
Raw Score: 168; E-Value: 6e-90
Query Start/End: Original strand, 3 - 264
Target Start/End: Original strand, 54312 - 54573
Alignment:
3 tatagtaaaaacgaggactgacattacatatgaccgcatttgcacaagcatatccaattgtgtaaatctcctttaaaaaatggcagaaatgcacttttga 102  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||  ||||||||| | ||    
54312 tatagtaaaaacgaggacagacattacatatgaccgcatttgcacaagcatacccaatcgtgtaaatctcctttaaaaaatggcttaaatgcactctgga 54411  T
103 ccctttatgtttgtcgtcgtagccattttga-cccctaacnnnnnnnnngcaatttttaccccctaatttagccttgtttagggaaatatgctcttttgg 201  Q
    ||| ||||||||||||||||||||||||||| || |||||         ||||||||||||||||||||| |||||||||||||||||||||||||||||    
54412 ccccttatgtttgtcgtcgtagccattttgatcctctaacaaaaaaaatgcaatttttaccccctaattttgccttgtttagggaaatatgctcttttgg 54511  T
202 ccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctca 264  Q
    |||||| ||||||||||||||||||||||||||||| ||||||||||| |||||| |||||||    
54512 ccccttatctttacaaaaagttgcgattatggcccc-tttttgggacatgtggcggcttctca 54573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 93; Significance: 3e-45; HSPs: 33)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 89 - 264
Target Start/End: Original strand, 16858357 - 16858535
Alignment:
89 aaatgcacttttgaccctttatgtttgtcgtcgtagccattttgacccctaacnnnnnnnnngcaatttttaccccctaatttagccttgtttagggaaa 188  Q
    ||||||||||||| |||  ||| ||||||||||||||||||||||||||||||         |||||||||||||||||||||  ||||||||||| |||    
16858357 aaatgcacttttggccccctatatttgtcgtcgtagccattttgacccctaacaaaaaaaatgcaatttttaccccctaattttaccttgtttaggaaaa 16858456  T
189 tat--gctcttttggccccttgtctttacaaaa-agttgcgattatggccccttttttgggacacgtggcgtcttctca 264  Q
    |||  |||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||| |||||| |||||||    
16858457 tatatgctcttttggccccttatctttacaaaaaagttgcgattatggccccttttttgggacatgtggcggcttctca 16858535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 185 - 339
Target Start/End: Complemental strand, 48472041 - 48471887
Alignment:
185 gaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaagggg 284  Q
    |||||||||| ||||| |||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||| || |||| |||||||||||    
48472041 gaaatatgct-ttttgaccccttatctttacaaaaagttgcgattatggtcccttttttgggacacgtggcgtcttctcagcaattttgggatgaagggg 48471943  T
285 actaaaattgcca-nnnnnnnaatagggagccaaaatcacaatattttgaaacata 339  Q
     | ||||||||||        ||||||| ||||||||| ||| |||||||||||||    
48471942 gccaaaattgccattttttttaatagggggccaaaatcgcaacattttgaaacata 48471887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 182 - 295
Target Start/End: Original strand, 24962076 - 24962188
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||||| ||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||  ||||||     
24962076 agggaaatatgct-ttttgaccccttatctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcagcaattttttgatgaaa 24962174  T
282 gggactaaaattgc 295  Q
    ||||| ||||||||    
24962175 gggaccaaaattgc 24962188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 182 - 297
Target Start/End: Complemental strand, 19078106 - 19077992
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||| | ||||| |||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||| || |||| |||||||     
19078106 agggaaatatgtt-ttttgaccccttatctttacaaaaagttgcgattatgaccccttttttgggacacgtggcgtcttctcagcaatttttggatgaaa 19078008  T
282 gggactaaaattgcca 297  Q
    ||| | ||||||||||    
19078007 ggggccaaaattgcca 19077992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 182 - 297
Target Start/End: Complemental strand, 19125996 - 19125882
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||| | ||||| |||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||| || |||| |||||||     
19125996 agggaaatatgtt-ttttgaccccttatctttacaaaaagttgcgattatgaccccttttttgggacacgtggcgtcttctcagcaatttttggatgaaa 19125898  T
282 gggactaaaattgcca 297  Q
    ||| | ||||||||||    
19125897 ggggccaaaattgcca 19125882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 182 - 297
Target Start/End: Original strand, 24196384 - 24196498
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||||| ||||| |||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||| || |||| ||| |||     
24196384 agggaaatatgct-ttttgaccccttatctttacaaaaagttgcgaatatggccccttttttgggacacgtggcgtcttctcagcaatttttggacgaaa 24196482  T
282 gggactaaaattgcca 297  Q
    ||| | ||||||||||    
24196483 ggggccaaaattgcca 24196498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 182 - 295
Target Start/End: Original strand, 3616922 - 3617034
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||| | ||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| |||| ||     
3616922 agggaaatatgtt-ttttgaccccttatctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcagcaatttttggataaaa 3617020  T
282 gggactaaaattgc 295  Q
    ||| | ||||||||    
3617021 ggggccaaaattgc 3617034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 151 - 255
Target Start/End: Complemental strand, 18106922 - 18106817
Alignment:
151 gcaatttttaccccctaatttagccttgtttagggaaatatgctcttttggccccttgtctttac-aaaaagttgcgattatggccccttttttgggaca 249  Q
    |||||||| |||||||| ||| ||| ||||||||||||||||||||||||  ||||| ||||| | ||||| ||||||||||||||||||||||||||||    
18106922 gcaattttgaccccctatttttgccatgtttagggaaatatgctcttttgatcccttatctttgcaaaaaaattgcgattatggccccttttttgggaca 18106823  T
250 cgtggc 255  Q
    ||||||    
18106822 cgtggc 18106817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 185 - 294
Target Start/End: Original strand, 29676205 - 29676313
Alignment:
185 gaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaagggg 284  Q
    |||||||||| ||||| |||||| |||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||  |||||| |||    
29676205 gaaatatgct-ttttgaccccttatctttataaaaagttgcgattatggccccttttttgggacacgtggcgccttctcaacaattttttgatgaaaggg 29676303  T
285 actaaaattg 294  Q
     | |||||||    
29676304 gccaaaattg 29676313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 196 - 295
Target Start/End: Complemental strand, 4059690 - 4059591
Alignment:
196 ttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaaggggactaaaattgc 295  Q
    ||||| |||||| ||||||||||||||||||||||||| || ||||||||||||||||||||||||||| || |||| ||||||| ||| | ||||||||    
4059690 ttttgaccccttatctttacaaaaagttgcgattatggtccattttttgggacacgtggcgtcttctcagcaattttgggatgaaaggggccaaaattgc 4059591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 182 - 295
Target Start/End: Original strand, 24749921 - 24750033
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||||| ||||| |||||| |||||||||||||||||||||||||||| |||||||| |||||||||||||||| | || ||||  ||||||     
24749921 agggaaatatgct-ttttgaccccttatctttacaaaaagttgcgattatggcccattttttggaacacgtggcgtcttcttagcaatttttagatgaaa 24750019  T
282 gggactaaaattgc 295  Q
    ||| | ||||||||    
24750020 ggggccaaaattgc 24750033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 196 - 297
Target Start/End: Complemental strand, 27093020 - 27092919
Alignment:
196 ttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaaggggactaaaattgc 295  Q
    ||||| |||||| ||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| || |||| |||||||  || | ||||||||    
27093020 ttttgaccccttatctttacaaaaagttgcaattatggccccttttttggaacacgtggcgtcttctcagcaattttgggatgaaatgggccaaaattgc 27092921  T
296 ca 297  Q
    ||    
27092920 ca 27092919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 151 - 264
Target Start/End: Complemental strand, 23279807 - 23279692
Alignment:
151 gcaatttttaccccctaatttagccttgtttagggaaatatgctcttttggccccttgtctttacaaaa-agttgcgattatgg-ccccttttttgggac 248  Q
    |||||||| ||||| |||||| ||| |||||||| ||||||||||||||| ||| || ||||||||||| |||||| ||||||| |||||| |||||||     
23279807 gcaattttgaccccttaattttgccatgtttaggaaaatatgctcttttgcccctttatctttacaaaatagttgcaattatggcccccttgtttgggat 23279708  T
249 acgtggcgtcttctca 264  Q
    |||||||| |||||||    
23279707 acgtggcggcttctca 23279692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 186 - 264
Target Start/End: Complemental strand, 16551821 - 16551743
Alignment:
186 aaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctca 264  Q
    ||||||| ||||||| |||||| ||||  |||||||||||||||||||||| | |||||||||||||||||||||||||    
16551821 aaatatgatcttttgaccccttatcttctcaaaaagttgcgattatggcccttgttttgggacacgtggcgtcttctca 16551743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 187 - 280
Target Start/End: Complemental strand, 28920833 - 28920740
Alignment:
187 aatatgctcttttggccccttgtctttacaaaaagttgcgattatgg-ccccttttttgggacacgtggcgtcttctcaacagttttaggatgaa 280  Q
    |||||||| ||||| |||||| |||||||||||||| |||||||||| |||||||||||||||| |||||||||||||| || |||| |||||||    
28920833 aatatgct-ttttgaccccttatctttacaaaaagtggcgattatggcccccttttttgggacatgtggcgtcttctcagcaatttttggatgaa 28920740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 182 - 295
Target Start/End: Complemental strand, 43706835 - 43706723
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||| | ||||| |||||| |||||||||||||||||||||||| ||||||||  |||||||||||| |||||| | || |||| |||||||     
43706835 agggaaatatgtt-ttttgaccccttatctttacaaaaagttgcgattatgaccccttttccgggacacgtggcatcttctgagcaattttgggatgaaa 43706737  T
282 gggactaaaattgc 295  Q
    ||| | ||||||||    
43706736 ggggccaaaattgc 43706723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 182 - 295
Target Start/End: Complemental strand, 46432397 - 46432285
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||| | ||||| |||||| |||||||||||||||||||||||| |||||||| ||||||||||||| |||||  | || |||| |||||||     
46432397 agggaaatatgtt-ttttgaccccttatctttacaaaaagttgcgattatgaccccttttctgggacacgtggcatcttccgagcaattttgggatgaaa 46432299  T
282 gggactaaaattgc 295  Q
    ||| | ||||||||    
46432298 ggggccaaaattgc 46432285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 182 - 264
Target Start/End: Complemental strand, 29182182 - 29182100
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctca 264  Q
    ||||||||||| ||||||| |||||| ||||  || ||||||||||||||||||| ||||||| ||||||| |||||||||||    
29182182 agggaaatatgatcttttgaccccttatcttctcataaagttgcgattatggcccattttttgagacacgttgcgtcttctca 29182100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 182 - 339
Target Start/End: Original strand, 2425346 - 2425503
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||| | ||||   ||||| |||||||||||||||||||||||| ||| |||| ||||||||||||| |||||| | || |||| |||||||     
2425346 agggaaatatgttttttttaacccttatctttacaaaaagttgcgattatgacccattttctgggacacgtggcatcttctgagcaattttgggatgaaa 2425445  T
282 gggactaaaattgccannnnnnnaatagggagccaaaatcacaatattttgaaacata 339  Q
     || | |||||||| |       ||||||| ||||||||| ||| ||| |||||||||    
2425446 tgggccaaaattgctatttttttaatagggggccaaaatcgcaacattatgaaacata 2425503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 184 - 272
Target Start/End: Complemental strand, 2657692 - 2657605
Alignment:
184 ggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagtttt 272  Q
    ||||||||||||||||| |||||| |||||  ||||||||| ||||||| ||| |||||| ||||||||||||| ||||||||| ||||    
2657692 ggaaatatgctcttttgaccccttatcttttaaaaaagttgtgattatgaccctttttttaggacacgtggcgt-ttctcaacaatttt 2657605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 182 - 264
Target Start/End: Complemental strand, 2260560 - 2260478
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctca 264  Q
    ||||||||||| | ||||  |||||| ||||  ||||||||||||||| || |||||||||||||| ||||||||||||||||    
2260560 agggaaatatgatattttaaccccttatcttctcaaaaagttgcgattctgaccccttttttgggatacgtggcgtcttctca 2260478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 202 - 295
Target Start/End: Complemental strand, 51719284 - 51719191
Alignment:
202 ccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaaggggactaaaattgc 295  Q
    |||||| |||||||||||||||||||||||| |||||||| || || ||||||| |||||| | || |||| | ||||| ||||| ||||||||    
51719284 ccccttatctttacaaaaagttgcgattatgaccccttttctgagatacgtggcatcttctgagcaattttggaatgaaagggaccaaaattgc 51719191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 182 - 264
Target Start/End: Complemental strand, 4455224 - 4455142
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctca 264  Q
    ||||||||||| | ||||| || ||| ||||  |||||||||||||||||||||  |||||||||||| ||||| ||||||||    
4455224 agggaaatatgattttttgaccacttatcttctcaaaaagttgcgattatggccatttttttgggacatgtggcatcttctca 4455142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 194 - 272
Target Start/End: Complemental strand, 9554371 - 9554293
Alignment:
194 tcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagtttt 272  Q
    ||||||| |||||| ||||  ||||||||||||| |||||||||| ||||| ||||||||||| |||||| ||| ||||    
9554371 tcttttgaccccttatcttctcaaaaagttgcgactatggcccctgttttgagacacgtggcgccttctctacaatttt 9554293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 186 - 272
Target Start/End: Complemental strand, 31084789 - 31084704
Alignment:
186 aaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagtttt 272  Q
    ||||||||| ||||| |||||| ||||||||||||||| |||||||| |||| ||||||||||| |||| |  ||||||||| ||||    
31084789 aaatatgct-ttttgaccccttatctttacaaaaagtttcgattatgaccccctttttgggacatgtggggctttctcaacaatttt 31084704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 196 - 262
Target Start/End: Original strand, 47685237 - 47685303
Alignment:
196 ttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttct 262  Q
    ||||| ||||||  ||||||||||||||||||| ||| || ||||||| ||||||||||||||||||    
47685237 ttttgaccccttacctttacaaaaagttgcgataatgacctcttttttaggacacgtggcgtcttct 47685303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 179 - 262
Target Start/End: Complemental strand, 28552502 - 28552417
Alignment:
179 tttagggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatgg--ccccttttttgggacacgtggcgtcttct 262  Q
    |||||||||||| ||||||||| ||| |  ||||||||||||||||| ||| |||  ||||| ||||| |||||||||| ||||||    
28552502 tttagggaaataagctcttttgacccttaatctttacaaaaagttgcaattttggcccccctattttgagacacgtggcatcttct 28552417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 185 - 264
Target Start/End: Original strand, 22786155 - 22786231
Alignment:
185 gaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctca 264  Q
    |||||||| ||||||| |||||| ||||  |||||||||| |||   ||||||| ||||||||||| |||||||||||||    
22786155 gaaatatgatcttttgaccccttatcttctcaaaaagttgtgat---ggcccctgttttgggacacttggcgtcttctca 22786231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 177 - 261
Target Start/End: Complemental strand, 27495192 - 27495107
Alignment:
177 tgtttagggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggcccctt-ttttgggacacgtggcgtcttc 261  Q
    |||||||  |||||| ||||||||| | ||| ||||||| ||||||| ||||| ||||||| | ||||||||||||||| ||||||    
27495192 tgtttagaaaaatatactcttttggtctcttatctttaccaaaagttacgattttggccccatgttttgggacacgtggtgtcttc 27495107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 234 - 272
Target Start/End: Original strand, 21148121 - 21148159
Alignment:
234 ccccttttttgggacacgtggcgtcttctcaacagtttt 272  Q
    |||||||||||||||||||||||| |||||| |||||||    
21148121 ccccttttttgggacacgtggcgttttctcagcagtttt 21148159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 186 - 264
Target Start/End: Original strand, 21185330 - 21185407
Alignment:
186 aaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctca 264  Q
    ||||||| ||||||| |||| | ||||  ||||||||||||||||| | ||||||||||| ||||| |||| |||||||    
21185330 aaatatgatcttttgaccccctatcttctcaaaaagttgcgattat-gacccttttttggaacacgaggcggcttctca 21185407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 179 - 267
Target Start/End: Complemental strand, 6285361 - 6285272
Alignment:
179 tttagggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggcccctt-ttttgggacacgtggcgtcttctcaaca 267  Q
    |||||||| ||| ||||| ||| ||  || ||||||||||||||||| ||| || |||||| ||| | |||| |||||||||||||||||    
6285361 tttagggatataagctctattgaccatttatctttacaaaaagttgcaattttgaccccttatttcgagacatgtggcgtcttctcaaca 6285272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 182 - 259
Target Start/End: Original strand, 9387816 - 9387893
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtct 259  Q
    ||||||||||  ||||||| ||| || ||||  |||||| ||||||||||| | ||| |||||||||| |||||||||    
9387816 agggaaatataatcttttgaccctttatcttctcaaaaatttgcgattatgacacctgttttgggacatgtggcgtct 9387893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 85; Significance: 2e-40; HSPs: 41)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 182 - 339
Target Start/End: Original strand, 18695126 - 18695282
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||||| ||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||  ||||||     
18695126 agggaaatatgct-ttttgaccccttatctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcagcaattttgagatgaaa 18695224  T
282 gggactaaaattgccannnnnnnaatagggagccaaaatcacaatattttgaaacata 339  Q
    ||| | ||||||||||       ||||||| ||||||||| |||||||||||||||||    
18695225 ggggccaaaattgccatttttttaatagggggccaaaatcgcaatattttgaaacata 18695282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 182 - 297
Target Start/End: Original strand, 245717 - 245831
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||||| ||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| ||||||||    
245717 agggaaatatgct-ttttgaccccttatctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcagcaattttcggatgaag 245815  T
282 gggactaaaattgcca 297  Q
    ||| | ||||||||||    
245816 ggggccaaaattgcca 245831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 182 - 339
Target Start/End: Complemental strand, 26639218 - 26639061
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||||  ||||| |||||| ||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||| |||| ||||||||    
26639218 agggaaatatgcg-ttttgaccccttatctttacaaaaagttgcaattatggcctcttttttgggacacgtggcgtcttctcaacaattttgggatgaag 26639120  T
282 gggactaaaattgcca-nnnnnnnaatagggagccaaaatcacaatattttgaaacata 339  Q
    ||| | ||||||||||        ||||||||| ||||||||||| |||||||||||||    
26639119 ggggccaaaattgccattttttttaatagggagtcaaaatcacaacattttgaaacata 26639061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 182 - 339
Target Start/End: Complemental strand, 25557056 - 25556900
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||| | ||||| |||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||| || |||| |||||||     
25557056 agggaaatatgtt-ttttgaccccttatctttacaaaaagttgcaattatggccccttttttgggacacgtggcgtcttctcagcaattttgggatgaaa 25556958  T
282 gggactaaaattgccannnnnnnaatagggagccaaaatcacaatattttgaaacata 339  Q
    ||| | ||||||||||       ||||||| ||||||||  ||| |||||||||||||    
25556957 ggggccaaaattgccaattttttaatagggggccaaaattgcaacattttgaaacata 25556900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 151 - 264
Target Start/End: Complemental strand, 20732744 - 20732631
Alignment:
151 gcaatttttaccccctaatttagccttgtttagggaaatatgctcttttggccccttgtcttta-caaaaagttgcgattatggccccttttttgggaca 249  Q
    |||||||| |||||||||||| ||| ||||||||||||||||||||||||| ||||| |||||| ||||||||||||||| |||||||||| ||||||||    
20732744 gcaattttgaccccctaattttgccatgtttagggaaatatgctcttttgg-cccttatctttaccaaaaagttgcgattttggcccctttgttgggaca 20732646  T
250 cgtggcgtcttctca 264  Q
    ||||||| |||||||    
20732645 cgtggcggcttctca 20732631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 182 - 297
Target Start/End: Complemental strand, 16901178 - 16901064
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||| | ||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| |||||||     
16901178 agggaaatatgtt-ttttgaccccttatctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcagcaattttgggatgaaa 16901080  T
282 gggactaaaattgcca 297  Q
     || | ||||||||||    
16901079 tgggccaaaattgcca 16901064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 182 - 297
Target Start/End: Complemental strand, 40428820 - 40428706
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||||| ||||| |||||| |||||||||||| ||||||||||| ||||||||||||||||||||||||||||||| || |||| ||| ||||    
40428820 agggaaatatgct-ttttgaccccttatctttacaaaaaattgcgattatgaccccttttttgggacacgtggcgtcttctcagcaattttgggacgaag 40428722  T
282 gggactaaaattgcca 297  Q
    ||| | ||||||||||    
40428721 ggggccaaaattgcca 40428706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 152 - 264
Target Start/End: Original strand, 18739807 - 18739920
Alignment:
152 caatttttaccccctaatttagccttgtttagggaaatatgctcttttggccccttgtcttta-caaaaagttgcgattatggccccttttttgggacac 250  Q
    ||||||| ||||| |||||| ||| |||||||||||||||||||||||||||| || |||||| ||||||||| ||||| || |||||||||||||||||    
18739807 caattttgaccccttaattttgccatgtttagggaaatatgctcttttggccctttatctttatcaaaaagttacgattttgaccccttttttgggacac 18739906  T
251 gtggcgtcttctca 264  Q
    |||||| |||||||    
18739907 gtggcggcttctca 18739920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 182 - 297
Target Start/End: Original strand, 19169466 - 19169580
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||||| ||||| |||||| ||||||||||||||||| |||||||||| |||||| | |||||||||||||||||| || ||||||||| |||    
19169466 agggaaatatgct-ttttgaccccttatctttacaaaaagttgcaattatggcccatttttttgaacacgtggcgtcttctcagcaattttaggatcaag 19169564  T
282 gggactaaaattgcca 297  Q
    ||| | ||||||||||    
19169565 ggggccaaaattgcca 19169580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 151 - 264
Target Start/End: Complemental strand, 38545490 - 38545376
Alignment:
151 gcaatttttaccccctaatttagccttgtttagggaaatatgctcttttggccccttgtctttaca-aaaagttgcgattatggccccttttttgggaca 249  Q
    |||||||| ||||| |||||| ||| |||||||||| ||||||||||||||||| || |||||||| |||| ||||||||||| ||||||||| ||||||    
38545490 gcaattttgaccccttaattttgccatgtttagggatatatgctcttttggcccattatctttacaaaaaaattgcgattatgacccctttttcgggaca 38545391  T
250 cgtggcgtcttctca 264  Q
    ||||||| |||||||    
38545390 cgtggcggcttctca 38545376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 151 - 252
Target Start/End: Original strand, 16287577 - 16287678
Alignment:
151 gcaatttttaccccctaatttagccttgtttagggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacac 250  Q
    |||||||| |||||||||||| ||| |||||||  |||||||||||||||| ||||| ||||||||||||||||| ||| |||||| ||||||| |||||    
16287577 gcaattttgaccccctaattttgccatgtttagaaaaatatgctcttttggtcccttatctttacaaaaagttgcaattttggccctttttttgagacac 16287676  T
251 gt 252  Q
    ||    
16287677 gt 16287678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 204 - 339
Target Start/End: Complemental strand, 16307636 - 16307501
Alignment:
204 ccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaaggggactaaaattgccannnnnn 303  Q
    |||| ||||||||||||||||| |||||| |||||||||| ||||| |||||||||||||| || ||||| |||||| ||| | ||||||||||          
16307636 ccttatctttacaaaaagttgcaattatgacccctttttttggacatgtggcgtcttctcagcaattttaagatgaaaggggccaaaattgccatttttt 16307537  T
304 naatagggagccaaaatcacaatattttgaaacata 339  Q
     |||||||  |||||||||||| ||||| |||||||    
16307536 taataggggaccaaaatcacaacattttaaaacata 16307501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 151 - 264
Target Start/End: Original strand, 38322291 - 38322405
Alignment:
151 gcaatttttaccccctaatttagccttgtttagggaaatatgctcttttggccccttgtctttacaaaa-agttgcgattatggccccttttttgggaca 249  Q
    |||||||| |||||||||||| ||| ||||||||||||| |  | ||||| || ||| ||||||||||| |||||||||| || ||||||||||||||||    
38322291 gcaattttgaccccctaattttgccatgtttagggaaatttagttttttgacctcttatctttacaaaaaagttgcgattttgaccccttttttgggaca 38322390  T
250 cgtggcgtcttctca 264  Q
    ||||||| |||||||    
38322391 cgtggcggcttctca 38322405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 185 - 262
Target Start/End: Complemental strand, 17825676 - 17825599
Alignment:
185 gaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttct 262  Q
    |||||||| ||||||| ||| || ||||  ||||||||||||||||||||||||||||||||||||||||||||||||    
17825676 gaaatatgttcttttgaccctttatcttgtcaaaaagttgcgattatggccccttttttgggacacgtggcgtcttct 17825599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 182 - 264
Target Start/End: Complemental strand, 38476651 - 38476570
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctca 264  Q
    ||||||||||| ||||||| |||||| ||||  ||||||||||||||||| | ||||||||||||||||||||||||||||||    
38476651 agggaaatatgatcttttgaccccttatcttctcaaaaagttgcgattat-gacccttttttgggacacgtggcgtcttctca 38476570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 177 - 274
Target Start/End: Complemental strand, 8674043 - 8673947
Alignment:
177 tgtttagggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttag 274  Q
    |||||||||||||||||||||||| |||||| |||||||||||||||| ||||||  ||| ||||||  |||||||| | ||||||||||| ||||||    
8674043 tgtttagggaaatatgctcttttgaccccttatctttacaaaaagttgtgattataacccatttttt-agacacgtgacatcttctcaacaattttag 8673947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 182 - 295
Target Start/End: Complemental strand, 31055495 - 31055383
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||| | ||||| |||||| |||||||||||| ||||||||||| |||||||| ||||||||||||| |||||| | || |||| |||||||     
31055495 agggaaatatgtt-ttttgaccccttatctttacaaaaaattgcgattatgaccccttttctgggacacgtggcatcttctgagcaattttgggatgaaa 31055397  T
282 gggactaaaattgc 295  Q
    ||| | ||||||||    
31055396 ggggccaaaattgc 31055383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 182 - 293
Target Start/End: Original strand, 36641266 - 36641376
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||||| ||||| ||| || |||||| |||||||||||||||||  |||||||||||||||| ||||||||||||| || ||||  ||||||     
36641266 agggaaatatgct-ttttgacccgttatctttataaaaagttgcgattatgatcccttttttgggacacatggcgtcttctcagcaattttttgatgaaa 36641364  T
282 gggactaaaatt 293  Q
    ||| | ||||||    
36641365 ggggccaaaatt 36641376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 196 - 339
Target Start/End: Original strand, 7835845 - 7835988
Alignment:
196 ttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaaggggactaaaattgc 295  Q
    ||||| |||||| |||||||||| || || ||||||||||| ||||||  |||| |||||||||||||||||  ||| ||||||| | | ||| ||||||    
7835845 ttttgaccccttatctttacaaagaggtgggattatggcccttttttttagacatgtggcgtcttctcaacaactttgggatgaaagaggctagaattgc 7835944  T
296 cannnnnnnaatagggagccaaaatcacaatattttgaaacata 339  Q
    ||       |||||| |||||||||| ||||||||| |||||||    
7835945 catttttttaataggaagccaaaatcgcaatattttaaaacata 7835988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 182 - 295
Target Start/End: Original strand, 10379404 - 10379516
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||| | ||||| |||||| |||||||||||||||||||||||| |||||||| || |||| ||||| |||||| |  | |||| |||||||     
10379404 agggaaatatgtt-ttttgaccccttatctttacaaaaagttgcgattatgaccccttttctgagacaagtggcatcttctgagaaattttgggatgaaa 10379502  T
282 gggactaaaattgc 295  Q
    ||||| ||||||||    
10379503 gggaccaaaattgc 10379516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 182 - 286
Target Start/End: Complemental strand, 37961430 - 37961326
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||| ||| ||||||| ||||||  |||  ||||||||||| |||||||||||||||  ||||||||||| ||||||||| || |||| |||||||     
37961430 agggaaaaatgatcttttgaccccttaacttctcaaaaagttgcaattatggccccttttaagggacacgtggtgtcttctcagcaattttgggatgaaa 37961331  T
282 gggac 286  Q
    |||||    
37961330 gggac 37961326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 151 - 256
Target Start/End: Original strand, 42757550 - 42757657
Alignment:
151 gcaatttttaccccctaatttagccttgtttagggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggcccc--ttttttgggac 248  Q
    |||||||| |||||||||||| ||| |||||||| |||| || ||||||| ||| || ||||||||||||||| ||||| || ||||  |||||| ||||    
42757550 gcaattttaaccccctaattttgccatgtttaggaaaatttgttcttttgaccctttatctttacaaaaagttacgattttgaccccattttttttggac 42757649  T
249 acgtggcg 256  Q
    ||||||||    
42757650 acgtggcg 42757657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 185 - 272
Target Start/End: Original strand, 462891 - 462978
Alignment:
185 gaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagtttt 272  Q
    |||||||| ||||||| |||||| |||||||||||||||||||||||| ||   |||||  ||||||||||||||| |||||| ||||    
462891 gaaatatgttcttttgaccccttatctttacaaaaagttgcgattatgaccttcttttttagacacgtggcgtcttttcaacaatttt 462978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 182 - 280
Target Start/End: Original strand, 38408751 - 38408848
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaa 280  Q
    ||||||||||| | ||||| |||||| ||||||||||||||||| |||||| ||| |||| ||||||||||||| |||||| | || |||| |||||||    
38408751 agggaaatatgtt-ttttgaccccttatctttacaaaaagttgctattatgacccattttctgggacacgtggcatcttctgagcaattttgggatgaa 38408848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 151 - 255
Target Start/End: Original strand, 26214094 - 26214199
Alignment:
151 gcaatttttaccccctaatttagccttgtttagggaaatatgctcttttggccccttgtctttacaaaa-agttgcgattatggccccttttttgggaca 249  Q
    |||||||| |||||||| ||| | | |||||||| ||||||| | |||| ||||||| ||||| ||||| ||||||||||||||||  ||||||| ||||    
26214094 gcaattttgaccccctatttttgtcatgtttaggtaaatatgttttttttgccccttatcttttcaaaaaagttgcgattatggccaattttttgtgaca 26214193  T
250 cgtggc 255  Q
    ||||||    
26214194 cgtggc 26214199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 215 - 262
Target Start/End: Complemental strand, 41663672 - 41663625
Alignment:
215 caaaaagttgcgattatggccccttttttgggacacgtggcgtcttct 262  Q
    |||||| |||||||||||||||||||||||||||||||||| ||||||    
41663672 caaaaaattgcgattatggccccttttttgggacacgtggcatcttct 41663625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 182 - 276
Target Start/End: Complemental strand, 10293268 - 10293175
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttagga 276  Q
    ||||||||||| | ||||| | |||| ||||| |||||||||||||||||| || |||||||  |||| |||||||||||||| || ||||||||    
10293268 agggaaatatgtt-ttttgactccttatctttccaaaaagttgcgattatgacctcttttttaagacatgtggcgtcttctcagcatttttagga 10293175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 182 - 255
Target Start/End: Complemental strand, 23040130 - 23040057
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggc 255  Q
    ||||||||||| ||||||| |||||| ||||  |||||||||||||||||| ||| |||||||| | |||||||    
23040130 agggaaatatgatcttttgaccccttatcttctcaaaaagttgcgattatgaccctttttttggaaaacgtggc 23040057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 186 - 267
Target Start/End: Complemental strand, 35302092 - 35302011
Alignment:
186 aaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaaca 267  Q
    ||||||| |||||| | ||||| ||||   |||||| |||||||||||||||| || ||||||||||||||||| |||||||    
35302092 aaatatgatctttttgacccttatcttctaaaaaagctgcgattatggcccctgttctgggacacgtggcgtctgctcaaca 35302011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 262
Target Start/End: Original strand, 2373267 - 2373347
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttct 262  Q
    ||||||||||| | || || |||||| | ||  |||||| ||||||||||| ||||||||| |||||||||||||||||||    
2373267 agggaaatatgatattatgaccccttattttctcaaaaatttgcgattatgacccctttttggggacacgtggcgtcttct 2373347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 89 - 137
Target Start/End: Complemental strand, 3023799 - 3023751
Alignment:
89 aaatgcacttttgaccctttatgtttgtcgtcgtagccattttgacccc 137  Q
    ||||||| ||||| ||||||||||||||||||||||| |||||||||||    
3023799 aaatgcatttttggccctttatgtttgtcgtcgtagcaattttgacccc 3023751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 209 - 264
Target Start/End: Complemental strand, 23765545 - 23765492
Alignment:
209 tctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctca 264  Q
    |||||||||||||||||||||||||   ||||||| ||||||||||||||||||||    
23765545 tctttacaaaaagttgcgattatgg--tctttttttggacacgtggcgtcttctca 23765492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 209 - 264
Target Start/End: Complemental strand, 23815393 - 23815340
Alignment:
209 tctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctca 264  Q
    |||||||||||||||||||||||||   ||||||| ||||||||||||||||||||    
23815393 tctttacaaaaagttgcgattatgg--tctttttttggacacgtggcgtcttctca 23815340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 186 - 294
Target Start/End: Original strand, 34125186 - 34125294
Alignment:
186 aaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaagggga 285  Q
    ||||||| || |||| || ||| ||||  |||||||||||||||||| ||| | |||||| ||||||||||| ||||||  | |||| |||||||||||     
34125186 aaatatgatcatttgacctcttatcttctcaaaaagttgcgattatgacccatgttttggaacacgtggcgtattctcagtaattttgggatgaaggggg 34125285  T
286 ctaaaattg 294  Q
    | |||||||    
34125286 ccaaaattg 34125294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 182 - 264
Target Start/End: Complemental strand, 17704768 - 17704687
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctca 264  Q
    |||||||||| || ||||| ||| || ||||||||||||||||  ||||||||||||||||||||| | ||||| | ||||||    
17704768 agggaaatatact-ttttgaccctttatctttacaaaaagttgaaattatggccccttttttgggataagtggcatgttctca 17704687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 211 - 260
Target Start/End: Original strand, 7187340 - 7187388
Alignment:
211 tttacaaaaagttgcgattatggccccttttttgggacacgtggcgtctt 260  Q
    ||||||||||||||||||||| | ||||||||||||||| ||||||||||    
7187340 tttacaaaaagttgcgattat-gacccttttttgggacatgtggcgtctt 7187388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 179 - 264
Target Start/End: Complemental strand, 36954556 - 36954471
Alignment:
179 tttagggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctca 264  Q
    |||| |||||||||||| |||  ||| || ||||||||||||||||| ||| ||| | || |||||||||||||| | ||||||||    
36954556 tttaaggaaatatgctcattttaccctttatctttacaaaaagttgcaattttggtcactgttttgggacacgtgacctcttctca 36954471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 198 - 273
Target Start/End: Complemental strand, 28538577 - 28538502
Alignment:
198 ttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagtttta 273  Q
    ||||||| || ||||||| ||||| ||| ||| || ||||| ||||||||||||||||||||| | |||| |||||    
28538577 ttggccctttatctttacgaaaagctgcaattttgacccctattttgggacacgtggcgtcttgttaacaatttta 28538502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 90 - 132
Target Start/End: Complemental strand, 16287785 - 16287743
Alignment:
90 aatgcacttttgaccctttatgtttgtcgtcgtagccattttg 132  Q
    |||||||||||||| | ||||||||||||||||||| ||||||    
16287785 aatgcacttttgactccttatgtttgtcgtcgtagcaattttg 16287743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 203 - 264
Target Start/End: Complemental strand, 15885326 - 15885265
Alignment:
203 cccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctca 264  Q
    ||||| ||||||||||||||| ||||||||| |  |||||||||||| |||| || ||||||    
15885326 cccttatctttacaaaaagtttcgattatggtcatttttttgggacatgtggtgttttctca 15885265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #41
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 179 - 235
Target Start/End: Original strand, 24025171 - 24025227
Alignment:
179 tttagggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggcc 235  Q
    ||||| |||||| ||||||||| ||| || ||||||||||||||||| ||| |||||    
24025171 tttagagaaataagctcttttgaccctttatctttacaaaaagttgcaattttggcc 24025227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 79; Significance: 8e-37; HSPs: 64)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 151 - 264
Target Start/End: Complemental strand, 38723017 - 38722903
Alignment:
151 gcaatttttaccccctaatttagccttgtttagggaaatatgctcttttggccccttgtcttta-caaaaagttgcgattatggccccttttttgggaca 249  Q
    |||||||| |||||||||||| ||| ||||||||||||||||||||||||| ||||| |||||| ||||||||||||||| |||||||||||||||||||    
38723017 gcaattttgaccccctaattttgccatgtttagggaaatatgctcttttggacccttatctttaccaaaaagttgcgattttggccccttttttgggaca 38722918  T
250 cgtggcgtcttctca 264  Q
    ||||||| |||||||    
38722917 cgtggcggcttctca 38722903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 182 - 339
Target Start/End: Complemental strand, 24597696 - 24597541
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||| | ||||| |||||| ||||||||||||||||||||||||||||||| |||| ||||||||||||||||||| || |||| ||||||||    
24597696 agggaaatatgtt-ttttgaccccttctctttacaaaaagttgcgattatggccccttgtttgagacacgtggcgtcttctcagcaattttgggatgaag 24597598  T
282 gggactaaaattgccannnnnnnaatagggagccaaaatcacaatattttgaaacata 339  Q
    ||| | ||||||||||       ||||||| ||||||||||||| |||||||||||||    
24597597 ggg-ccaaaattgccatttttttaatagggggccaaaatcacaacattttgaaacata 24597541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 182 - 296
Target Start/End: Complemental strand, 3562614 - 3562501
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||||| ||||| |||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||  ||||||||||||    
3562614 agggaaatatgct-ttttgaccccttatctttacaaaaagttgcgattatggccccttttttaggacacgtggcgtcttctcagcaagtttaggatgaag 3562516  T
282 gggactaaaattgcc 296  Q
    ||| | |||||||||    
3562515 ggggccaaaattgcc 3562501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 186 - 339
Target Start/End: Original strand, 31494037 - 31494190
Alignment:
186 aaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaagggga 285  Q
    ||||||||| ||||| |||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||| || |||||||||||| |||     
31494037 aaatatgct-ttttgaccccttatctttacaaaaagttgcgattatggccccttttttggaacacgtggcgtcttctcagcaattttaggatgaaagggg 31494135  T
286 ctaaaattgcca-nnnnnnnaatagggagccaaaatcacaatattttgaaacata 339  Q
    | ||||||||||        ||||||| ||||||||| ||| |||||||||||||    
31494136 ccaaaattgccattttttttaatagggggccaaaatcgcaacattttgaaacata 31494190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 182 - 339
Target Start/End: Complemental strand, 27869376 - 27869220
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||||| ||||| |||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||| || |||| ||||||||    
27869376 agggaaatatgct-ttttgaccccttatctttacaaaaagttgcgattatggccccttttttgggacacatggcgtcttctcagcaattttgggatgaag 27869278  T
282 gggactaaaattgccannnnnnnaatagggagccaaaatcacaatattttgaaacata 339  Q
    | | | ||||||| ||       ||||||| | ||||||| ||| |||||||||||||    
27869277 gaggccaaaattgtcatttttttaatagggggtcaaaatcgcaacattttgaaacata 27869220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 182 - 339
Target Start/End: Complemental strand, 19195394 - 19195238
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||| | ||||| |||||| |||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||| |||| |||||||     
19195394 agggaaatatgtt-ttttgaccccttatctttacaaaaagttgtgattatggccccttttttgggacatgtggcgtcttctcaacaatttttggatgaaa 19195296  T
282 gggactaaaattgccannnnnnnaatagggagccaaaatcacaatattttgaaacata 339  Q
    ||| | |||||||| |       |||||||  |||||||  |||||||||||||||||    
19195295 ggggccaaaattgctatttttttaataggggaccaaaattgcaatattttgaaacata 19195238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 97 - 267
Target Start/End: Complemental strand, 14197092 - 14196920
Alignment:
97 ttttgaccctttatgtttgtcgtcgtagccattttgacccc-taacnnnnnnnnngcaatttttaccccctaatttagccttgtttagggaaatatgctc 195  Q
    ||||| ||| ||||||||||||||||||| ||||||||||| ||||          ||||||||||| |||||||| |||||||||||||||||||||||    
14197092 ttttggccccttatgtttgtcgtcgtagctattttgaccccctaacaaaaaaaatacaatttttaccgcctaattttgccttgtttagggaaatatgctc 14196993  T
196 ttttggccccttgtctttaca--aaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaaca 267  Q
    ||||| ||| || ||||||||  ||||||||| ||||||||||| ||||||| ||| |||||| ||||||||||    
14196992 ttttgaccctttatctttacaaaaaaagttgcaattatggcccc-tttttggaacatgtggcggcttctcaaca 14196920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 182 - 297
Target Start/End: Original strand, 20636742 - 20636855
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||||| ||||| |||||| |||||||||||||||||||||||| |||||||||||||||||||||||| |||||| || |||| ||||||||    
20636742 agggaaatatgct-ttttgaccccttatctttacaaaaagttgcgattatgaccccttttttgggacacgtggcgttttctcagcaattttgggatgaag 20636840  T
282 gggactaaaattgcca 297  Q
    ||| | ||||||||||    
20636841 ggg-ccaaaattgcca 20636855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 151 - 267
Target Start/End: Complemental strand, 9154512 - 9154395
Alignment:
151 gcaatttttaccccctaatttagccttgtttagggaaatatgctcttttggccccttgtctttacaaaaa-gttgcgattatggccccttttttgggaca 249  Q
    ||||||||  ||||||| ||| ||| ||||||| ||||||||||||||||| ||||| ||||| |||||| ||||||||||||||||||||| |||||||    
9154512 gcaattttggccccctatttttgccatgtttagagaaatatgctcttttggtcccttatctttgcaaaaaagttgcgattatggccccttttatgggaca 9154413  T
250 cgtggcgtcttctcaaca 267  Q
    ||||||| ||||||||||    
9154412 cgtggcggcttctcaaca 9154395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 182 - 295
Target Start/End: Complemental strand, 21224533 - 21224421
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||||| ||||| |||||| |||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| || |||| |||||||     
21224533 agggaaatatgct-ttttgaccccttatctttacaaaaagttgcgattatggccctttttttgagacacgtggcgtcttctcagcaatttttggatgaaa 21224435  T
282 gggactaaaattgc 295  Q
    ||| | ||||||||    
21224434 ggggccaaaattgc 21224421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 182 - 295
Target Start/End: Complemental strand, 35337703 - 35337591
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||||| ||||| |||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||| | ||||  ||||||     
35337703 agggaaatatgct-ttttgaccccttatctttacaaaaagttgcgattatgaccccttttttgggacacgtggcgtcttctcaataattttttgatgaaa 35337605  T
282 gggactaaaattgc 295  Q
    ||| | ||||||||    
35337604 ggggccaaaattgc 35337591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 185 - 294
Target Start/End: Complemental strand, 36746681 - 36746573
Alignment:
185 gaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaagggg 284  Q
    ||||||||| |||||  |||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| ||||||| |||    
36746681 gaaatatgc-cttttaaccccttatctttacaaaaagttgcgattatgaccccttttttgggacacgtggcgtcttctcaacaattttgggatgaaaggg 36746583  T
285 actaaaattg 294  Q
     | |||||||    
36746582 gccaaaattg 36746573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 182 - 295
Target Start/End: Complemental strand, 41452430 - 41452318
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||||| ||||| |||||| |||||||||||||||||||||||| |||||||||||||||||||| |||||||||| || |||| |||||||     
41452430 agggaaatatgct-ttttgaccccttatctttacaaaaagttgcgattatgaccccttttttgggacacgtgtcgtcttctcagcaatttttggatgaaa 41452332  T
282 gggactaaaattgc 295  Q
    ||| | ||||||||    
41452331 ggggccaaaattgc 41452318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 182 - 339
Target Start/End: Complemental strand, 13577967 - 13577811
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||||| ||||| ||| || ||| ||||||||||||  ||||||||||||||||||| |||||||||||||||||| || |||| |||||||     
13577967 agggaaatatgct-ttttgaccctttatctatacaaaaagttgaaattatggccccttttttggaacacgtggcgtcttctcagcaattttgggatgaaa 13577869  T
282 gggactaaaattgccannnnnnnaatagggagccaaaatcacaatattttgaaacata 339  Q
    ||| | ||||||||||       ||||||| ||||||||| ||| |||||||||||||    
13577868 ggggccaaaattgccatttttttaatagggggccaaaatcgcaacattttgaaacata 13577811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 182 - 294
Target Start/End: Original strand, 42271455 - 42271566
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||||| ||||| |||||| | |||||||||||||||||||||||||| |||||||| |||||||||||||||||| || |||| ||||||||    
42271455 agggaaatatgct-ttttgaccccttatgtttacaaaaagttgcgattatggccctttttttggaacacgtggcgtcttctcagcaattttcggatgaag 42271553  T
282 gggactaaaattg 294  Q
    ||| | |||||||    
42271554 ggggccaaaattg 42271566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 179 - 294
Target Start/End: Original strand, 6650629 - 6650744
Alignment:
179 tttagggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatg 278  Q
    |||||||||||||||||||||| |||||| ||||  |||||||||||||||||||||||| ||||| |||| |||||||||||||| || |||| ||| |    
6650629 tttagggaaatatgctcttttgaccccttatcttctcaaaaagttgcgattatggcccctgttttgagacatgtggcgtcttctcatcaattttgggacg 6650728  T
279 aaggggactaaaattg 294  Q
    || ||| |||||||||    
6650729 aaaggggctaaaattg 6650744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 89 - 262
Target Start/End: Complemental strand, 46267521 - 46267348
Alignment:
89 aaatgcacttttgaccctttatgtttgtcgtcgtagccattttgacccc-taacnnnnnnnnngcaatttttaccccctaatttagccttgtttagggaa 187  Q
    |||||||||||||| || |||||||||| |||||||| ||||||||||| ||||          ||||||||||||| ||||||  ||||||||||| ||    
46267521 aaatgcacttttgatcccttatgtttgttgtcgtagctattttgaccccctaacaaaaaaata-caatttttacccc-taattttaccttgtttaggaaa 46267424  T
188 atatgctcttttggccccttgtctttacaaaaa-gttgcgattatggccccttttttgggacacgtggcgtcttct 262  Q
    |||||||| |||| ||  || |||||||||||| ||||||||||||||||||||||||||||| |||||| |||||    
46267423 atatgctcatttgacctattatctttacaaaaaagttgcgattatggccccttttttgggacatgtggcggcttct 46267348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 186 - 339
Target Start/End: Complemental strand, 11843355 - 11843202
Alignment:
186 aaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaagggga 285  Q
    ||||||||| ||||| |||||| || |||||||||||||| ||||||||||||||||| | | |||||||||||||||| || |||| ||||||| |||     
11843355 aaatatgct-ttttgaccccttatccttacaaaaagttgcaattatggcccctttttttgaatacgtggcgtcttctcagcaattttgggatgaaagggg 11843257  T
286 ctaaaattgcca-nnnnnnnaatagggagccaaaatcacaatattttgaaacata 339  Q
    | ||||||||||        ||||||||||||||||| ||| |||||||||||||    
11843256 ccaaaattgccattttttttaatagggagccaaaatcgcaacattttgaaacata 11843202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 182 - 335
Target Start/End: Original strand, 8526919 - 8527070
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||||| ||||| |||||  | ||||||||||||||| |||||||||||||||||| |||||||||| |||||||| || |||| ||||||||    
8526919 agggaaatatgct-ttttgacccctatt-tttacaaaaagttgcaattatggccccttttttgagacacgtggcatcttctcagcaattttgggatgaag 8527016  T
282 gggactaaaattgccannnnnnnaatagggagccaaaatcacaatattttgaaa 335  Q
     || | ||||||||||       ||||||| ||||||||| ||| |||||||||    
8527017 agggccaaaattgccatttttttaatagggggccaaaatcgcaacattttgaaa 8527070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 182 - 280
Target Start/End: Original strand, 2331136 - 2331233
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaa 280  Q
    ||||||||||||| ||||| | |||| |||||||||||||||||||||||||||  |||||||||||| |||||||||||||| || |||| |||||||    
2331136 agggaaatatgct-ttttgactccttatctttacaaaaagttgcgattatggcctattttttgggacaagtggcgtcttctcagcaatttttggatgaa 2331233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 182 - 264
Target Start/End: Original strand, 15681752 - 15681834
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctca 264  Q
    |||||| |||| ||||||| |||||| ||||  ||||||||||||||||||||| ||||||||||||||||||||||||||||    
15681752 agggaactatgatcttttgaccccttatcttgtcaaaaagttgcgattatggcctcttttttgggacacgtggcgtcttctca 15681834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 151 - 264
Target Start/End: Original strand, 24730822 - 24730936
Alignment:
151 gcaatttttaccccctaatttagccttgtttagggaaatatgctcttttggccccttgtctttac-aaaaagttgcgattatggccccttttttgggaca 249  Q
    |||||||| |||| ||||||| | | |||||| |||||||||||||||||||||| | ||||||| ||||||||||||  |||| ||||||||||| |||    
24730822 gcaattttgaccctctaattttgtcatgtttaaggaaatatgctcttttggccccgtatctttacaaaaaagttgcgaccatggtcccttttttggaaca 24730921  T
250 cgtggcgtcttctca 264  Q
    ||||||| |||||||    
24730922 cgtggcggcttctca 24730936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 151 - 267
Target Start/End: Complemental strand, 45782237 - 45782119
Alignment:
151 gcaatttttaccccctaatttagccttgt-ttagggaaatatgctcttttggccccttgtctttacaaaaag-ttgcgattatggccccttttttgggac 248  Q
    |||||||| ||||| |||||| ||| ||| ||||| |||||||||||||| | ||||| ||||||||||||  |||||||||||||||||||||||||||    
45782237 gcaattttgaccccttaattttgccatgtgttaggaaaatatgctcttttcgtcccttatctttacaaaaaaattgcgattatggccccttttttgggac 45782138  T
249 acgtggcgtcttctcaaca 267  Q
    ||| || | ||||||||||    
45782137 acgcggtggcttctcaaca 45782119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 181 - 294
Target Start/End: Original strand, 5087117 - 5087230
Alignment:
181 tagggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaa 280  Q
    |||||||||||| | ||||| |||||| ||||| ||||||||||||||||||  |||| ||||||||||||||||||||||||| || |||| ||| |||    
5087117 tagggaaatatgattttttgaccccttatcttttcaaaaagttgcgattatgatccctattttgggacacgtggcgtcttctcatcaattttgggacgaa 5087216  T
281 ggggactaaaattg 294  Q
     ||| | |||||||    
5087217 aggggccaaaattg 5087230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 196 - 297
Target Start/End: Complemental strand, 19919771 - 19919670
Alignment:
196 ttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaaggggactaaaattgc 295  Q
    ||||| |||||| |||||||||||||||| |||||| |||||||||||||||||||| |||| |||||| || |||| ||||||||||  | ||||||||    
19919771 ttttgaccccttatctttacaaaaagttgtgattatagccccttttttgggacacgtagcgttttctcagcaattttgggatgaagggtgccaaaattgc 19919672  T
296 ca 297  Q
    ||    
19919671 ca 19919670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 182 - 267
Target Start/End: Original strand, 23439716 - 23439801
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaaca 267  Q
    |||||||||||||||||||  ||||| |||||  ||||||||||||||||| ||||| ||||||||||||||||| ||||||||||    
23439716 agggaaatatgctcttttgatcccttatcttttaaaaaagttgcgattatgacccctgttttgggacacgtggcggcttctcaaca 23439801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 179 - 260
Target Start/End: Original strand, 47113234 - 47113315
Alignment:
179 tttagggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtctt 260  Q
    |||||||||||| | ||||||||||| || |||||| |||||||||||||| |||||||| |||||||||||||||||||||    
47113234 tttagggaaataagatcttttggccctttatctttataaaaagttgcgattttggcccctgttttgggacacgtggcgtctt 47113315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 182 - 295
Target Start/End: Complemental strand, 48176144 - 48176032
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||| | ||||| |||||| |||||||||||||||||||||||| |||||||| ||||||||||||| |||||| | || |||| |||||||     
48176144 agggaaatatgtt-ttttgaccccttatctttacaaaaagttgcgattatgaccccttttctgggacacgtggcatcttctgagcaattttgggatgaaa 48176046  T
282 gggactaaaattgc 295  Q
    ||| | ||||||||    
48176045 ggggccaaaattgc 48176032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 182 - 273
Target Start/End: Complemental strand, 39440302 - 39440211
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagtttta 273  Q
    ||||||||||| |||||||  ||||| ||||| |||||||||||||||||| ||||| |||| ||||| ||||||||||||||||| |||||    
39440302 agggaaatatgatcttttgatcccttatcttttcaaaaagttgcgattatgacccctgttttaggacatgtggcgtcttctcaacaatttta 39440211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 182 - 292
Target Start/End: Complemental strand, 21225729 - 21225621
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||||| ||| | ||||| ||||||||||||||||||||||||| ||  |||||||| ||||||| ||||||||||||| |||||||| |||     
21225729 agggaaatatgctattt-gacccctcgtctttacaaaaagttgcgattatgacca-ttttttggaacacgtgacgtcttctcaacaattttaggacgaaa 21225632  T
282 gggactaaaat 292  Q
    ||||| |||||    
21225631 gggaccaaaat 21225621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 182 - 294
Target Start/End: Original strand, 17305887 - 17305999
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggcccc-ttttttgggacacgtggcgtcttctcaacagttttaggatgaa 280  Q
    ||||||||||||| ||||| |||||| | |||||||||||||| ||||||| |||| |||||||||||| |||||||||||||| || |||| |||||||    
17305887 agggaaatatgct-ttttgaccccttatttttacaaaaagttgtgattatgacccccttttttgggacatgtggcgtcttctcatcaattttgggatgaa 17305985  T
281 ggggactaaaattg 294  Q
     ||| | |||||||    
17305986 agggcccaaaattg 17305999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 182 - 294
Target Start/End: Complemental strand, 9822281 - 9822170
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||| | ||||||| |||||| ||||  |||||||||||||||||| |||| |||||||||||| ||||||||||||| || |||| ||| |||     
9822281 agggaaatacgatcttttgaccccttatcttctcaaaaagttgcgattatgacccc-tttttgggacacatggcgtcttctcagcaattttgggacgaaa 9822183  T
282 gggactaaaattg 294  Q
    ||| |||||||||    
9822182 ggggctaaaattg 9822170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 182 - 294
Target Start/End: Complemental strand, 10724206 - 10724095
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||| | ||||||| |||||| ||||  |||||||||||||||||| |||| |||||||||||| ||||||||||||| || |||| ||| |||     
10724206 agggaaatacgatcttttgaccccttatcttctcaaaaagttgcgattatgacccc-tttttgggacacatggcgtcttctcagcaattttgggacgaaa 10724108  T
282 gggactaaaattg 294  Q
    ||| |||||||||    
10724107 ggggctaaaattg 10724095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 185 - 260
Target Start/End: Original strand, 4193675 - 4193750
Alignment:
185 gaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtctt 260  Q
    |||||||| ||||||| |||||| ||||| ||||||||||| |||||||||||||||||| |||||||| ||||||    
4193675 gaaatatgatcttttgaccccttatcttttcaaaaagttgcaattatggccccttttttgagacacgtgacgtctt 4193750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 182 - 264
Target Start/End: Original strand, 14624725 - 14624806
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctca 264  Q
    |||||||||| || ||||| ||| || ||||||||||||||||| ||||||||||||||||||||||||||||| | ||||||    
14624725 agggaaatatact-ttttgaccctttatctttacaaaaagttgcaattatggccccttttttgggacacgtggcatgttctca 14624806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 182 - 264
Target Start/End: Original strand, 39182056 - 39182138
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctca 264  Q
    ||||||||||| ||||||| |||||| ||||  ||||||||||||||||||||| || ||||||||||||||| || ||||||    
39182056 agggaaatatgatcttttgaccccttatcttctcaaaaagttgcgattatggcctctgttttgggacacgtggtgttttctca 39182138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 202 - 295
Target Start/End: Original strand, 10655471 - 10655564
Alignment:
202 ccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaaggggactaaaattgc 295  Q
    |||||| |||||||||||||||||||||||| ||| |||| ||||||||||||| |||||| | || |||| ||||||| ||| | ||||||||    
10655471 ccccttatctttacaaaaagttgcgattatgacccattttctgggacacgtggcatcttctgagcaattttgggatgaaaggggccaaaattgc 10655564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #38
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 182 - 267
Target Start/End: Original strand, 23473112 - 23473197
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaaca 267  Q
    ||||||||||||||||||||   ||| ||||| |||||||||| ||||||| || || ||||||||||||||||| ||||||||||    
23473112 agggaaatatgctcttttggtatcttatcttttcaaaaagttgtgattatgacctctgttttgggacacgtggcggcttctcaaca 23473197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #39
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 182 - 251
Target Start/End: Original strand, 26126376 - 26126445
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacg 251  Q
    ||||||||||| ||||||| |||||| ||||  |||||||||||||||||||||||| ||||||||||||    
26126376 agggaaatatgatcttttgaccccttatcttctcaaaaagttgcgattatggcccctgttttgggacacg 26126445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #40
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 177 - 264
Target Start/End: Original strand, 5348144 - 5348232
Alignment:
177 tgtttagggaaatatgctcttttggccccttgtctt-tacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctca 264  Q
    |||||||| ||||||||||||||| |||||| |||| || ||||||||||||||||||| ||| |||||||| | ||| ||||||||||    
5348144 tgtttaggaaaatatgctcttttgaccccttatcttctaaaaaaagttgcgattatggctcctgttttgggatatgtgacgtcttctca 5348232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #41
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 196 - 264
Target Start/End: Complemental strand, 10023952 - 10023885
Alignment:
196 ttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctca 264  Q
    ||||| |||||| ||||||||||||||||||| |||||||||| ||||||||||||||| |||||||||    
10023952 ttttgaccccttatctttacaaaaagttgcgaatatggcccct-ttttgggacacgtggtgtcttctca 10023885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #42
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 185 - 267
Target Start/End: Complemental strand, 23461200 - 23461118
Alignment:
185 gaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaaca 267  Q
    ||||||| ||||||||  || || || || |||||||||||||||||| ||||| ||||||||||||||||| ||||||||||    
23461200 gaaatattctcttttgatcctttatcatttcaaaaagttgcgattatgacccctgttttgggacacgtggcggcttctcaaca 23461118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #43
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 182 - 284
Target Start/End: Original strand, 24464698 - 24464800
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||| ||||||| |||||| ||||  ||||| ||||||||||||| |  | ||||| |||| |||||||||||||| || |||||| ||||||    
24464698 agggaaatatgatcttttgaccccttatcttctcaaaatgttgcgattatggtcattgttttgtgacatgtggcgtcttctcagcaattttagaatgaag 24464797  T
282 ggg 284  Q
    |||    
24464798 ggg 24464800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #44
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 184 - 272
Target Start/End: Original strand, 3148048 - 3148135
Alignment:
184 ggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagtttt 272  Q
    |||||||||||| |||| ||| ||  ||||||||||| |||| ||||| |||| |||||||||||||| ||||||||||||||| ||||    
3148048 ggaaatatgctcctttgaccctttaactttacaaaaaattgcaattatagccc-ttttttgggacacgaggcgtcttctcaacaatttt 3148135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #45
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 182 - 280
Target Start/End: Original strand, 43251387 - 43251486
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgt-ggcgtcttctcaacagttttaggatgaa 280  Q
    ||||||||||| ||||||| | | || ||||  ||||||||| |||||| | ||| |||||| |||||||| ||||||||||||||| ||||||||||||    
43251387 agggaaatatgatcttttgactctttatcttctcaaaaagttacgattaagacccttttttttggacacgtgggcgtcttctcaacatttttaggatgaa 43251486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #46
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 182 - 244
Target Start/End: Original strand, 5111561 - 5111623
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttg 244  Q
    ||||||||||| | ||||| |||||| ||||  ||||||||||||||||||||||||||||||    
5111561 agggaaatatgatattttgaccccttatcttctcaaaaagttgcgattatggccccttttttg 5111623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #47
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 182 - 264
Target Start/End: Original strand, 42303269 - 42303350
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctca 264  Q
    ||||||||||| ||||||| |||||| ||||  |||||| ||||||| ||| |||| |||||||||||||||| |||||||||    
42303269 agggaaatatgatcttttgaccccttatcttctcaaaaacttgcgatcatgacccc-tttttgggacacgtggtgtcttctca 42303350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #48
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 246
Target Start/End: Complemental strand, 4571525 - 4571461
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttggg 246  Q
    ||||||||||| ||||||| |||||| ||||  ||||||||||||||| |||||||| |||||||    
4571525 agggaaatatgatcttttgaccccttatcttctcaaaaagttgcgattgtggcccctgttttggg 4571461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #49
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 216 - 280
Target Start/End: Complemental strand, 33237561 - 33237497
Alignment:
216 aaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaa 280  Q
    ||||||||| ||||||| || || ||||||||||||||||||||||||| || |||| |||||||    
33237561 aaaaagttgtgattatgaccactgttttgggacacgtggcgtcttctcagcaattttgggatgaa 33237497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #50
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 225 - 264
Target Start/End: Original strand, 1921040 - 1921079
Alignment:
225 cgattatggccccttttttgggacacgtggcgtcttctca 264  Q
    |||||||||||||||||||||||||||||||| |||||||    
1921040 cgattatggccccttttttgggacacgtggcggcttctca 1921079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #51
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 182 - 297
Target Start/End: Original strand, 7365345 - 7365460
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||| | ||||| | |||| ||||  ||||||||||||||||| ||| || |||||||||||||| | |||||||| || |||| ||| |||     
7365345 agggaaatatgatattttgactccttatcttctcaaaaagttgcgattattgcctctgttttgggacacgtgacatcttctcagcaattttgggacgaaa 7365444  T
282 gggactaaaattgcca 297  Q
     || | ||||||||||    
7365445 agggccaaaattgcca 7365460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #52
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 185 - 260
Target Start/End: Original strand, 26385386 - 26385461
Alignment:
185 gaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtctt 260  Q
    |||||||| | ||||| || ||| ||||  |||||||||||||||||||||| | |||||||||| ||||||||||    
26385386 gaaatatgatattttgacctcttatcttctcaaaaagttgcgattatggcccatgttttgggacatgtggcgtctt 26385461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #53
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 182 - 264
Target Start/End: Complemental strand, 3403233 - 3403151
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctca 264  Q
    ||||||||||| |||||||  ||||| | ||  |||||| ||||||||||| || ||||||||||||| ||||||||| ||||    
3403233 agggaaatatgatcttttgatcccttatgttctcaaaaacttgcgattatgaccacttttttgggacatgtggcgtctcctca 3403151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #54
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 182 - 280
Target Start/End: Complemental strand, 18754447 - 18754350
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaa 280  Q
    ||||||||||| | ||||| |||||| ||||||||||| |||||||||||| | | |||| ||||||||||||  |||||| | || |||| |||||||    
18754447 agggaaatatgtt-ttttgaccccttatctttacaaaatgttgcgattatgacacattttctgggacacgtggtatcttctgatcaattttgggatgaa 18754350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #55
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 182 - 232
Target Start/End: Original strand, 20638614 - 20638663
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatg 232  Q
    ||||||||||||| ||||| |||||| ||||||||||||||||||||||||    
20638614 agggaaatatgct-ttttgaccccttatctttacaaaaagttgcgattatg 20638663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #56
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 226 - 295
Target Start/End: Original strand, 19493484 - 19493553
Alignment:
226 gattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaaggggactaaaattgc 295  Q
    ||||||||||||| |||| |||||||||||||||||||| |  |||| ||||||| ||| | ||||||||    
19493484 gattatggcccctgttttaggacacgtggcgtcttctcagccattttgggatgaaaggggccaaaattgc 19493553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #57
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 196 - 292
Target Start/End: Complemental strand, 44078039 - 44077942
Alignment:
196 ttttggccccttgtctttacaaaaa-gttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaaggggactaaaat 292  Q
    ||||| |||||| |||||||||||| |||||||||||| |  | |||||||||||| ||||||||||| | || |||| ||| ||| ||||| |||||    
44078039 ttttgaccccttatctttacaaaaaagttgcgattatgacatcctttttgggacacatggcgtcttcttagcaattttgggacgaaagggaccaaaat 44077942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #58
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 184 - 267
Target Start/End: Complemental strand, 23373571 - 23373487
Alignment:
184 ggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggcccctt-ttttgggacacgtggcgtcttctcaaca 267  Q
    ||||||| ||||||||| ||| || | |||||||| |||||| |||  ||||| || ||||||| ||||||||||||||||||||    
23373571 ggaaataagctcttttgaccctttatatttacaaatagttgcaatttcggcccattgttttgggtcacgtggcgtcttctcaaca 23373487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #59
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 182 - 268
Target Start/End: Original strand, 5776874 - 5776961
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggcccc-ttttttgggacacgtggcgtcttctcaacag 268  Q
    ||||||||| ||||||||||||  |  ||||| ||||||||||||||| ||||||| | |||||| ||| | | ||||||||||||||    
5776874 agggaaataagctcttttggccattcatctttgcaaaaagttgcgattttggccccatgttttggaacatgcgacgtcttctcaacag 5776961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #60
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 182 - 264
Target Start/End: Complemental strand, 24448225 - 24448142
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttt-tgggacacgtggcgtcttctca 264  Q
    ||||||||||| | || || |||||| ||||||||||||  || |||||||||||||||||  |||||||| | ||||||||||    
24448225 agggaaatatgtttttatgaccccttatctttacaaaaaaatgtgattatggcccctttttaagggacacgcgacgtcttctca 24448142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #61
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 162 - 255
Target Start/End: Original strand, 35533496 - 35533592
Alignment:
162 cccctaatttagccttgtttagggaaatatgctcttttggccccttgtcttt---acaaaaagttgcgattatggcccc-ttttttgggacacgtggc 255  Q
    |||||| ||| ||| |||||||| ||||||| | ||||| |||||| |||||   | ||||| |||||||||||||||| ||||||||||||||||||    
35533496 cccctatttttgccatgtttaggtaaatatgtttttttg-ccccttatctttgtaaaaaaaaattgcgattatggcccccttttttgggacacgtggc 35533592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #62
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 94 - 141
Target Start/End: Original strand, 46267256 - 46267303
Alignment:
94 cacttttgaccctttatgtttgtcgtcgtagccattttgacccctaac 141  Q
    |||||||| ||||||||||||| | ||||||| |||||||||||||||    
46267256 cacttttggccctttatgtttgccatcgtagcaattttgacccctaac 46267303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #63
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 258
Target Start/End: Original strand, 25002831 - 25002905
Alignment:
184 ggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtc 258  Q
    ||||||||| ||||||| |||||| ||||  || ||| ||||||||||| ||| | ||||||||||| |||||||    
25002831 ggaaatatgatcttttgaccccttatcttctcataaatttgcgattatgacccgtgttttgggacacatggcgtc 25002905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #64
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 89 - 137
Target Start/End: Original strand, 9154302 - 9154350
Alignment:
89 aaatgcacttttgaccctttatgtttgtcgtcgtagccattttgacccc 137  Q
    |||||||||||||||||| |||||||| | ||||||| |||||| ||||    
9154302 aaatgcacttttgaccctctatgtttgccatcgtagcaattttggcccc 9154350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 78; Significance: 3e-36; HSPs: 48)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 182 - 295
Target Start/End: Complemental strand, 13397856 - 13397744
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||||| ||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| ||||||||    
13397856 agggaaatatgct-ttttgaccccttatctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcagcaattttcggatgaag 13397758  T
282 gggactaaaattgc 295  Q
    ||| | ||||||||    
13397757 ggggccaaaattgc 13397744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 178 - 295
Target Start/End: Complemental strand, 25618813 - 25618697
Alignment:
178 gtttagggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggat 277  Q
    ||||||||||||||||||||||| |||||| |||||||||||||| ||||||||||||||| ||||||||||||||||||||||||| || |||| ||||    
25618813 gtttagggaaatatgctcttttgaccccttatctttacaaaaagtggcgattatggcccct-ttttgggacacgtggcgtcttctcagcaatttttggat 25618715  T
278 gaaggggactaaaattgc 295  Q
    ||| ||||| ||||||||    
25618714 gaaagggaccaaaattgc 25618697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 182 - 335
Target Start/End: Original strand, 4357375 - 4357527
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||||| ||||| |||||| |||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| || |||||| ||||||    
4357375 agggaaatatgct-ttttgaccccttatctttacaaaaagttgcgattatggccctttttttgggacacctggcgtcttctcagcaattttagaatgaag 4357473  T
282 gggactaaaattgccannnnnnnaatagggagccaaaatcacaatattttgaaa 335  Q
    ||| | ||||||||||       ||||||| | ||||||| ||| |||||||||    
4357474 ggggccaaaattgccatttttttaatagggggtcaaaatcgcaacattttgaaa 4357527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 182 - 339
Target Start/End: Complemental strand, 13826600 - 13826444
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||||| ||||| |||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| || |||| |||||||     
13826600 agggaaatatgct-ttttgaccccttatctttacaaaaagttgcgattatagccccttttttgggacacgtggcgtcttctcagcaattttgggatgaaa 13826502  T
282 gggactaaaattgccannnnnnnaatagggagccaaaatcacaatattttgaaacata 339  Q
    ||| | ||||||||||       ||||||| | ||||||| ||| ||||| |||||||    
13826501 ggggccaaaattgccatttttttaatagggggtcaaaatcgcaacatttttaaacata 13826444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 182 - 339
Target Start/End: Complemental strand, 15058999 - 15058844
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||||| ||||| |||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| || |||| |||||||     
15058999 agggaaatatgct-ttttgaccccttatctttacaaaaagttgcgattatagccccttttttgggacacgtggcgtcttctcagcaattttgggatgaaa 15058901  T
282 gggactaaaattgccannnnnnnaatagggagccaaaatcacaatattttgaaacata 339  Q
    ||| | ||| ||||||       ||||||| ||||||||| ||| |||||||||||||    
15058900 ggggccaaagttgccatatttttaataggg-gccaaaatcgcaacattttgaaacata 15058844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 151 - 262
Target Start/End: Complemental strand, 14612351 - 14612239
Alignment:
151 gcaatttttaccccctaatttagccttgtttagggaaatatgctcttttggccccttgtcttta-caaaaagttgcgattatggccccttttttgggaca 249  Q
    |||||||| |||||||||||| ||| ||||||||||||||||||||||||||||||| |||||| ||||||||| ||||| ||||||| ||||| |||||    
14612351 gcaattttgaccccctaattttgccatgtttagggaaatatgctcttttggccccttatctttaccaaaaagttacgattttggccccctttttaggaca 14612252  T
250 cgtggcgtcttct 262  Q
    ||||||| |||||    
14612251 cgtggcggcttct 14612239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 186 - 297
Target Start/End: Complemental strand, 5304524 - 5304414
Alignment:
186 aaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaagggga 285  Q
    ||||||||| ||||| |||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||| || ||||  ||||||||||     
5304524 aaatatgct-ttttgaccccttatctttacaaaaagttgcgattatggcccattttttgggacacgtggcgtcttctcagcaattttgcgatgaaggggg 5304426  T
286 ctaaaattgcca 297  Q
    | ||||||||||    
5304425 ccaaaattgcca 5304414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 182 - 280
Target Start/End: Original strand, 35475412 - 35475509
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaa 280  Q
    ||||||||||| | ||||| |||||| |||||||||||||| ||||||||| ||||||||||||||||||||||||||||||| || ||||||||||||    
35475412 agggaaatatgtt-ttttgaccccttatctttacaaaaagtagcgattatgaccccttttttgggacacgtggcgtcttctcagcaattttaggatgaa 35475509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 183 - 264
Target Start/End: Complemental strand, 2715897 - 2715817
Alignment:
183 gggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctca 264  Q
    |||||||||||| ||||| |||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
2715897 gggaaatatgct-ttttgaccccttatctttacaaaaagttgcgattatggcccattttttgggacacgtggcgtcttctca 2715817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 182 - 297
Target Start/End: Original strand, 27018337 - 27018451
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||| | ||||| |||||| || |||||||||||||| |||||||||||||||||||||||||||||||||||||| || |||| |||||||     
27018337 agggaaatatgtt-ttttgaccccttatccttacaaaaagttgcaattatggccccttttttgggacacgtggcgtcttctcagcaattttgggatgaaa 27018435  T
282 gggactaaaattgcca 297  Q
     || | ||||||||||    
27018436 tgggccaaaattgcca 27018451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 151 - 264
Target Start/End: Original strand, 33978822 - 33978936
Alignment:
151 gcaatttttaccccctaatttagccttgtttagggaaatatgctcttttggccccttgtctttacaaaa-agttgcgattatggccccttttttgggaca 249  Q
    |||||||| |||||||||| | ||| ||||||| |||||||||  |||||||| ||| ||||||||||| ||||||||||||| ||||||||||||||||    
33978822 gcaattttgaccccctaatattgccatgtttagcgaaatatgcatttttggcctcttatctttacaaaaaagttgcgattatgaccccttttttgggaca 33978921  T
250 cgtggcgtcttctca 264  Q
    ||||||  |||||||    
33978922 cgtggcagcttctca 33978936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 151 - 264
Target Start/End: Original strand, 32335915 - 32336029
Alignment:
151 gcaatttttaccccctaatttagccttgtttagggaaatatgctcttttggccccttgtctttac-aaaaagttgcgattatggccccttttttgggaca 249  Q
    |||||||| ||||| |||||| ||| |||||||||| ||||||||||||||||  || ||||||| ||||| ||||||||||| ||||||||| || |||    
32335915 gcaattttgaccccttaattttgccatgtttagggatatatgctcttttggcctattatctttacaaaaaaattgcgattatgacccctttttcggaaca 32336014  T
250 cgtggcgtcttctca 264  Q
    ||||||| |||||||    
32336015 cgtggcggcttctca 32336029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 182 - 264
Target Start/End: Complemental strand, 51291351 - 51291269
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctca 264  Q
    ||||||||||| ||||||| |||||| ||||  |||||||||| |||||||||||||||||||||||| ||||||||||||||    
51291351 agggaaatatgatcttttgaccccttatcttctcaaaaagttgtgattatggccccttttttgggacatgtggcgtcttctca 51291269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 182 - 263
Target Start/End: Original strand, 4098779 - 4098860
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctc 263  Q
    ||||||||||| ||||||| |||||| ||||  ||||||||||| |||| ||||||||||||||||||||||||||||||||    
4098779 agggaaatatgatcttttgaccccttatcttctcaaaaagttgcaattaaggccccttttttgggacacgtggcgtcttctc 4098860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 196 - 297
Target Start/End: Complemental strand, 6789126 - 6789025
Alignment:
196 ttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaaggggactaaaattgc 295  Q
    ||||| ||| || |||||||||||| ||||||||||| ||| ||||||||||||||||||||||||| | || |||| ||||||||||| | ||||||||    
6789126 ttttgacccgttatctttacaaaaaattgcgattatgcccctttttttgggacacgtggcgtcttcttagcaattttgggatgaagggggccaaaattgc 6789027  T
296 ca 297  Q
    ||    
6789026 ca 6789025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 152 - 264
Target Start/End: Complemental strand, 7540302 - 7540189
Alignment:
152 caatttttaccccctaatttagccttgtttagggaaatatgctcttttggccccttgtctttaca-aaaagttgcgattatggccccttttttgggacac 250  Q
    ||||||| |||||||| ||| ||| |||||||||||||||||||||||| ||| || ||||| || |||| || |||||||| |||||||||||||||||    
7540302 caattttgaccccctatttttgccatgtttagggaaatatgctcttttgaccctttatctttgcataaaaattccgattatgaccccttttttgggacac 7540203  T
251 gtggcgtcttctca 264  Q
    |||||  |||||||    
7540202 gtggcagcttctca 7540189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 202 - 295
Target Start/End: Complemental strand, 19232505 - 19232412
Alignment:
202 ccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaaggggactaaaattgc 295  Q
    |||||| |||||||||||||||||||||||| |||||||| ||||||||||||| |||||| | || |||| ||||||| ||| | ||||||||    
19232505 ccccttatctttacaaaaagttgcgattatgaccccttttctgggacacgtggcatcttctgagcaattttgggatgaaaggggccaaaattgc 19232412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 182 - 263
Target Start/End: Original strand, 41034759 - 41034839
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctc 263  Q
    ||||||||||||| ||||| |||||| | ||||||||||||||||||||| | ||||||||||| |||||||||||||||||    
41034759 agggaaatatgct-ttttgaccccttatttttacaaaaagttgcgattatagtcccttttttggaacacgtggcgtcttctc 41034839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 177 - 293
Target Start/End: Complemental strand, 36729275 - 36729159
Alignment:
177 tgtttagggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttagga 276  Q
    |||||||||||||||| ||||||| |||||| ||||  ||||||||| |||||||| ||  |||||||||||| ||||||||||||||  | |||| |||    
36729275 tgtttagggaaatatgatcttttgaccccttatcttctcaaaaagtttcgattatgaccttttttttgggacatgtggcgtcttctcagtaattttggga 36729176  T
277 tgaaggggactaaaatt 293  Q
    |||| ||| | ||||||    
36729175 tgaaaggggccaaaatt 36729159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 182 - 297
Target Start/End: Complemental strand, 43793812 - 43793698
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||| | ||||| |||||| | ||||||||||||||||| |||| |||||||||||||||| |||||||||||||| || |||| ||| |||     
43793812 agggaaatatgtt-ttttgaccccttatatttacaaaaagttgcgaatatgaccccttttttgggacatgtggcgtcttctcagcaattttgggacgaaa 43793714  T
282 gggactaaaattgcca 297  Q
     || | ||||||||||    
43793713 tgggccaaaattgcca 43793698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 160 - 262
Target Start/End: Original strand, 47645516 - 47645619
Alignment:
160 accccctaatttagccttgtttagggaaatatgctcttttggccccttgtcttta-caaaaagttgcgattatggccccttttttgggacacgtggcgtc 258  Q
    |||||||||||| ||| |||||||| |||||||||||||||||||||| |||||| ||||||||| | ||| ||| | ||||||| ||| |||||||| |    
47645516 accccctaattttgccatgtttaggaaaatatgctcttttggccccttatctttaccaaaaagttacaattttggtctcttttttaggatacgtggcggc 47645615  T
259 ttct 262  Q
    ||||    
47645616 ttct 47645619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 216 - 335
Target Start/End: Original strand, 47869811 - 47869929
Alignment:
216 aaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaaggggactaaaattgccannnnnnnaatagggagcc 315  Q
    ||||||||||||||||| ||| |||||||| |||||||||||||||||| || |||| ||||||||| | | | ||||||||       ||||||| |||    
47869811 aaaaagttgcgattatgaccc-ttttttggaacacgtggcgtcttctcagcaattttgggatgaaggaggccagaattgccatttttttaatagggggcc 47869909  T
316 aaaatcacaatattttgaaa 335  Q
    |||||||||| |||||||||    
47869910 aaaatcacaacattttgaaa 47869929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 183 - 264
Target Start/End: Original strand, 52838352 - 52838431
Alignment:
183 gggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctca 264  Q
    |||||||||||| |||  | ||||| ||||||||||||||||||||||||| |||||||||| |||||||| ||||||||||    
52838352 gggaaatatgcttttt--gacccttatctttacaaaaagttgcgattatggtcccttttttgagacacgtgtcgtcttctca 52838431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 152 - 256
Target Start/End: Complemental strand, 40259778 - 40259673
Alignment:
152 caatttttaccccctaatttagccttgtttagggaaatatgctcttttggccccttgtctttaca-aaaagttgcgattatggccccttttttgggacac 250  Q
    ||||||| |||||||||| | ||| ||||||| |||||||||  ||||| |||||| |||||||| |||||||| | ||||| || ||||||||||||||    
40259778 caattttgaccccctaatattgccatgtttagcgaaatatgcatttttgcccccttatctttacaaaaaagttgtgcttatgacctcttttttgggacac 40259679  T
251 gtggcg 256  Q
    ||||||    
40259678 gtggcg 40259673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 152 - 255
Target Start/End: Complemental strand, 14784771 - 14784668
Alignment:
152 caatttttaccccctaatttagccttgtttagggaaatatgctcttttggccccttgtctttaca-aaaagttgcgattatggccccttttttgggacac 250  Q
    ||||||| |||||||||||| ||  |||||||||||||||| | ||||| |||||| |||||||| |||| |||| ||| ||| ||||||||||||||||    
14784771 caattttaaccccctaattttgctatgtttagggaaatatgtttttttgaccccttatctttacaaaaaatttgcaattttgg-cccttttttgggacac 14784673  T
251 gtggc 255  Q
    |||||    
14784672 gtggc 14784668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 209 - 265
Target Start/End: Original strand, 23362580 - 23362636
Alignment:
209 tctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaa 265  Q
    |||||||||||||||||||||||| ||||||||||||||||| | ||||||||||||    
23362580 tctttacaaaaagttgcgattatgaccccttttttgggacacattgcgtcttctcaa 23362636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 182 - 293
Target Start/End: Complemental strand, 41877207 - 41877099
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||||| ||||| |||||| ||||||||||  |||||||||||| |||||||||| |||||||||||||||| ||| || ||||  ||||||     
41877207 agggaaatatgct-ttttgaccccttatctttacaaa--gttgcgattatgaccccttttttaggacacgtggcgtcttttcagcaattttttgatgaaa 41877111  T
282 gggactaaaatt 293  Q
    ||| | ||||||    
41877110 ggggccaaaatt 41877099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 184 - 272
Target Start/End: Original strand, 45633561 - 45633648
Alignment:
184 ggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagtttt 272  Q
    ||||||||||||||||| |||||| |||||  ||||||||| ||||||| ||| |||||| ||||||||||||| ||||||||| ||||    
45633561 ggaaatatgctcttttgaccccttatcttttaaaaaagttgtgattatgaccctttttttaggacacgtggcgt-ttctcaacaatttt 45633648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 196 - 295
Target Start/End: Original strand, 25011871 - 25011970
Alignment:
196 ttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaaggggactaaaattgc 295  Q
    ||||| |||||| |||||||||||||||| |||||||  ||||||||||||||||||||| |||||| | || |||| | ||||| ||| | ||||||||    
25011871 ttttgaccccttatctttacaaaaagttgggattatgatcccttttttgggacacgtggcatcttctgagcaattttggaatgaaaggggccaaaattgc 25011970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 182 - 272
Target Start/End: Complemental strand, 1588594 - 1588506
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagtttt 272  Q
    ||||||||||| | ||||| |||||| ||||||||||||||||||||||| ||| | ||||||||||||||| |||||||| | |||||||    
1588594 agggaaatatgtt-ttttgaccccttatctttacaaaaagttgcgattatagcctc-tttttgggacacgtgacgtcttcttagcagtttt 1588506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 232 - 294
Target Start/End: Complemental strand, 13394668 - 13394606
Alignment:
232 ggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaaggggactaaaattg 294  Q
    ||||||||||||||||||||||||||||||||| || |||| ||||||||||| | |||||||    
13394668 ggccccttttttgggacacgtggcgtcttctcagcaattttcggatgaagggggccaaaattg 13394606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 179 - 264
Target Start/End: Complemental strand, 16291866 - 16291780
Alignment:
179 tttagggaaatatgctcttttggccccttgtctttacaaaaagttgcga-ttatggccccttttttgggacacgtggcgtcttctca 264  Q
    |||||||||||| | ||||||| |||||| |||||||||||||||| || ||| | ||||| ||||||| |||||||||||||||||    
16291866 tttagggaaataagatcttttgtccccttatctttacaaaaagttgtgatttaggccccctgttttgggtcacgtggcgtcttctca 16291780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 184 - 264
Target Start/End: Original strand, 2931446 - 2931524
Alignment:
184 ggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctca 264  Q
    ||||||||||| ||||| |||||| |||||||||||| |||||||| ||||||| ||||| |||| |||||||||||||||    
2931446 ggaaatatgct-ttttgaccccttatctttacaaaaaattgcgattgtggccccgttttttggac-cgtggcgtcttctca 2931524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 196 - 260
Target Start/End: Original strand, 55780522 - 55780586
Alignment:
196 ttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtctt 260  Q
    ||||| |||||| |||||||||||||||||||||||| |||||||| | ||||||||||| ||||    
55780522 ttttgaccccttatctttacaaaaagttgcgattatgaccccttttctaggacacgtggcatctt 55780586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 196 - 260
Target Start/End: Original strand, 55844702 - 55844766
Alignment:
196 ttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtctt 260  Q
    ||||| |||||| |||||||||||||||||||||||| |||||||| | ||||||||||| ||||    
55844702 ttttgaccccttatctttacaaaaagttgcgattatgaccccttttctaggacacgtggcatctt 55844766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 177 - 272
Target Start/End: Original strand, 14804436 - 14804531
Alignment:
177 tgtttagggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagtttt 272  Q
    ||||||||||||||| |||||||| |||||| |||||| ||||| ||| |||||||    |||||||| ||||| |||||| ||||||||| ||||    
14804436 tgtttagggaaatatactcttttgaccccttatctttagaaaaacttgtgattatgatatcttttttgagacacatggcgttttctcaacaatttt 14804531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 182 - 255
Target Start/End: Complemental strand, 9195845 - 9195773
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggc 255  Q
    ||||||||||| | ||||| |||||| |||||||||||||||||||||||| |||||||| | | |||||||||    
9195845 agggaaatatgtt-ttttgaccccttatctttacaaaaagttgcgattatgaccccttttctagaacacgtggc 9195773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 196 - 260
Target Start/End: Complemental strand, 4433351 - 4433287
Alignment:
196 ttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtctt 260  Q
    ||||| |||||| |||||||||||||||| ||||||| |||||||| | ||||||||||| ||||    
4433351 ttttgaccccttatctttacaaaaagttgtgattatgaccccttttctaggacacgtggcatctt 4433287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 179 - 264
Target Start/End: Original strand, 14857450 - 14857536
Alignment:
179 tttagggaaatatgctcttttggccccttgtctttacaaaaagttgcga-ttatggccccttttttgggacacgtggcgtcttctca 264  Q
    ||||| |||||| ||||||||| ||| || ||||||||||||||| | | || || ||||| ||||||||||| |||||||||||||    
14857450 tttagagaaataagctcttttgaccctttatctttacaaaaagtttcaatttttgccccctattttgggacacatggcgtcttctca 14857536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 182 - 272
Target Start/End: Complemental strand, 24626402 - 24626312
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagtttt 272  Q
    ||||||||||| ||||||| | |||| ||||  |||||||||| ||||||| ||| | |||||||||| |||| ||||||| |||| ||||    
24626402 agggaaatatgatcttttgactccttatcttctcaaaaagttgtgattatgacccatgttttgggacatgtggtgtcttcttaacaatttt 24626312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 179 - 272
Target Start/End: Complemental strand, 12101311 - 12101218
Alignment:
179 tttagggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagtttt 272  Q
    |||||| ||||| | |||||| |||  || ||||||||||||||||| ||| || | ||| ||||| |||| |||||||||||||| |||||||    
12101311 tttaggaaaataagttcttttagcctgttatctttacaaaaagttgcaattttgactcctgttttgagacatgtggcgtcttctcagcagtttt 12101218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 211 - 264
Target Start/End: Original strand, 15734549 - 15734602
Alignment:
211 tttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctca 264  Q
    |||||||||||||| ||| ||||||||||||||||||||||   ||||||||||    
15734549 tttacaaaaagttgtgataatggccccttttttgggacacgcaacgtcttctca 15734602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 89 - 137
Target Start/End: Original strand, 14612141 - 14612189
Alignment:
89 aaatgcacttttgaccctttatgtttgtcgtcgtagccattttgacccc 137  Q
    |||||||||||||  ||| |||||||||||||||||| |||||||||||    
14612141 aaatgcacttttggtcctctatgtttgtcgtcgtagcaattttgacccc 14612189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 209 - 264
Target Start/End: Original strand, 15795466 - 15795521
Alignment:
209 tctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctca 264  Q
    ||||| |||||||||| ||||||| ||| |||||| ||||| ||||||||||||||    
15795466 tcttttcaaaaagttgggattatgacccattttttaggacatgtggcgtcttctca 15795521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 202 - 272
Target Start/End: Complemental strand, 22057421 - 22057350
Alignment:
202 ccccttgtctttacaaaaagttgcgattatggcccctt-ttttgggacacgtggcgtcttctcaacagtttt 272  Q
    |||||| ||||||||||| |||||||||  |||||| | |||||||||||||||||| || | |||||||||    
22057421 ccccttatctttacaaaatgttgcgattccggccccctgttttgggacacgtggcgttttttaaacagtttt 22057350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 253
Target Start/End: Complemental strand, 5932041 - 5931971
Alignment:
184 ggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggcccctt-ttttgggacacgtg 253  Q
    ||||||| |||| ||||||||| | |||||||||||||||   ||||||||||||| |||| |||||||||    
5932041 ggaaataagctcctttggccccctatctttacaaaaagttataattatggccccttgttttaggacacgtg 5931971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 182 - 264
Target Start/End: Complemental strand, 6209423 - 6209339
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggcccc--ttttttgggacacgtggcgtcttctca 264  Q
    ||||||| ||| |||| || |||||| ||||  ||||||||||| | ||||||| |  ||||||||||||||||| |||||||||    
6209423 agggaaaaatgatcttatgaccccttatcttctcaaaaagttgcaactatggccacctttttttgggacacgtggtgtcttctca 6209339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #48
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 209 - 268
Target Start/End: Complemental strand, 43336095 - 43336035
Alignment:
209 tctttacaaaaagttgcgattatggc-cccttttttgggacacgtggcgtcttctcaacag 268  Q
    |||||||||||||||||||||  ||| |||| |||   |||||||||||||||||||||||    
43336095 tctttacaaaaagttgcgatttcggctccctgtttcaagacacgtggcgtcttctcaacag 43336035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 77; Significance: 1e-35; HSPs: 35)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 182 - 331
Target Start/End: Complemental strand, 4519048 - 4518901
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||| | ||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||  |||||||    
4519048 agggaaatatgtt-ttttgaccccttatctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacaattttgagatgaag 4518950  T
282 gggactaaaattgccannnnnnnaatagggagccaaaatcacaatatttt 331  Q
    ||| | ||||||||||       ||||||| ||||||||| |||||||||    
4518949 ggg-ccaaaattgccatttttttaatagggggccaaaatcgcaatatttt 4518901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 182 - 297
Target Start/End: Original strand, 38630178 - 38630292
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||||| ||||| |||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||| || ||||  |||||||    
38630178 agggaaatatgct-ttttgaccccttatctttacaaaaagttgcgattatgaccccttttttgggacacgtggcgtcttctcagcaattttgagatgaag 38630276  T
282 gggactaaaattgcca 297  Q
    ||| | ||||||||||    
38630277 ggggccaaaattgcca 38630292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 182 - 295
Target Start/End: Complemental strand, 19391568 - 19391456
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||| | ||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| |||||||     
19391568 agggaaatatgtt-ttttgaccccttatctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcagcaatttttggatgaaa 19391470  T
282 gggactaaaattgc 295  Q
    ||| | ||||||||    
19391469 ggggccaaaattgc 19391456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 196 - 297
Target Start/End: Complemental strand, 8802568 - 8802467
Alignment:
196 ttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaaggggactaaaattgc 295  Q
    ||||| |||||| ||||||||||||||||||||||||||||||||||||| ||| |||||||||||||| || |||| ||||||||||| | ||||||||    
8802568 ttttgaccccttatctttacaaaaagttgcgattatggccccttttttggaacatgtggcgtcttctcagcaattttgggatgaagggggccaaaattgc 8802469  T
296 ca 297  Q
    ||    
8802468 ca 8802467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 182 - 339
Target Start/End: Complemental strand, 5192452 - 5192296
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||| | ||||| || ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| |||| ||     
5192452 agggaaatatgtt-ttttgacctcttatctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcagcaatttttggataaaa 5192354  T
282 gggactaaaattgccannnnnnnaatagggagccaaaatcacaatattttgaaacata 339  Q
    ||| | |||||||| |       ||||||| ||||||||  ||| |||||||||||||    
5192353 ggggccaaaattgctatttatttaatagggggccaaaattgcaacattttgaaacata 5192296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 182 - 297
Target Start/End: Complemental strand, 18881685 - 18881570
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||| ||||||||| |||||| ||||||||||||||||| |||||| |||||| |||||||||| ||| |||||||||||| |||| ||| ||||    
18881685 agggaaatacgctcttttgaccccttatctttacaaaaagttgcaattatgaccccttatttgggacacttggtgtcttctcaacaattttgggacgaag 18881586  T
282 gggactaaaattgcca 297  Q
    ||| | ||||||||||    
18881585 ggggccaaaattgcca 18881570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 182 - 264
Target Start/End: Complemental strand, 4807781 - 4807700
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctca 264  Q
    ||||||||||||| ||||| |||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
4807781 agggaaatatgct-ttttgaccccttatctttacaaaaagttgcgattatggccccttttttggaacacgtggcgtcttctca 4807700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 182 - 264
Target Start/End: Original strand, 19924388 - 19924469
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctca 264  Q
    ||||||||||||| ||||| |||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
19924388 agggaaatatgct-ttttgaccccttatctttacaaaaagttgcgattatgaccccttttttgggacacgtggcgtcttctca 19924469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 182 - 280
Target Start/End: Original strand, 17648366 - 17648463
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaa 280  Q
    ||||||||||||| ||||| |||||| ||||||||||||||||||||||||||||| ||||| ||||||||||| |||||||| || |||| |||||||    
17648366 agggaaatatgct-ttttgaccccttatctttacaaaaagttgcgattatggccccctttttaggacacgtggcctcttctcagcaatttttggatgaa 17648463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 202 - 294
Target Start/End: Complemental strand, 7117276 - 7117184
Alignment:
202 ccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaaggggactaaaattg 294  Q
    |||||| ||||||||||||||||| |||||||||| |||||||||||| |||||||||||||| ||||||||||| ||| ||| | |||||||    
7117276 ccccttatctttacaaaaagttgcaattatggccctttttttgggacatgtggcgtcttctcagcagttttaggacgaaaggggccaaaattg 7117184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 182 - 297
Target Start/End: Complemental strand, 30784445 - 30784332
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||| | ||||| |||||| ||||||||||||||||||||||||| ||||||||||||||||||| | |||||||| || |||| |||||||     
30784445 agggaaatatgtt-ttttgaccccttatctttacaaaaagttgcgattatgg-cccttttttgggacacgtgacttcttctcagcaatttttggatgaat 30784348  T
282 gggactaaaattgcca 297  Q
    ||| | ||||||||||    
30784347 ggggccaaaattgcca 30784332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 182 - 345
Target Start/End: Original strand, 44147094 - 44147256
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||||| ||||| |||||| ||||||||||| |||||||||||| |||||||||||||| || ||||||||||||| || |||| |||| |||    
44147094 agggaaatatgct-ttttgaccccttatctttacaaaa-gttgcgattatgaccccttttttgggatacatggcgtcttctcagcaattttgggataaag 44147191  T
282 gggactaaaattgcca-nnnnnnnaatagggagccaaaatcacaatattttgaaacatattgggc 345  Q
    | | | ||||||| ||        ||||||| ||||||||| |||||||||||||||||| ||||    
44147192 gaggccaaaattgtcattttttttaatagggggccaaaatcgcaatattttgaaacatatggggc 44147256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 182 - 295
Target Start/End: Complemental strand, 12723442 - 12723330
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||| | ||||| ||| || ||||||||||||||||||||||||| |||||||||||||||| ||||||||||||| || |||| | |||||     
12723442 agggaaatatgtt-ttttgacccgttatctttacaaaaagttgcgattatggtcccttttttgggacacatggcgtcttctcagcaatttttgcatgaaa 12723344  T
282 gggactaaaattgc 295  Q
    ||| | ||||||||    
12723343 ggggccaaaattgc 12723330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 177 - 294
Target Start/End: Original strand, 23565207 - 23565323
Alignment:
177 tgtttagggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttagga 276  Q
    |||||| ||||||||||| ||||| |||||| |||||||||||||||||||||||||||| ||||||   ||| |||||||||||||| || |||| |||    
23565207 tgtttatggaaatatgct-ttttgaccccttatctttacaaaaagttgcgattatggcccttttttttaaacatgtggcgtcttctcagcaatttttgga 23565305  T
277 tgaaggggactaaaattg 294  Q
    |||| ||| | |||||||    
23565306 tgaaaggggccaaaattg 23565323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 182 - 297
Target Start/End: Complemental strand, 21666455 - 21666341
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||| | ||||| |||||| |||||| | |||||||| |||||||||||||||||||||||| ||||||||||||| || ||||  || ||||    
21666455 agggaaatatgtt-ttttgaccccttatctttagataaagttgcaattatggccccttttttgggacacatggcgtcttctcagcaattttgagacgaag 21666357  T
282 gggactaaaattgcca 297  Q
    ||| | ||||||||||    
21666356 ggggccaaaattgcca 21666341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 182 - 264
Target Start/End: Complemental strand, 22452354 - 22452273
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctca 264  Q
    ||||||||||||| ||||| || ||| ||||||||||||||||||| ||| |||| |||||||||||||||||||||||||||    
22452354 agggaaatatgct-ttttgacctcttatctttacaaaaagttgcgaatatagccctttttttgggacacgtggcgtcttctca 22452273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 153 - 240
Target Start/End: Original strand, 32731372 - 32731460
Alignment:
153 aatttttaccccctaatttagccttgtttagggaaatatgctcttttggccccttgtcttta-caaaaagttgcgattatggccccttt 240  Q
    |||||| ||||||||||||  || |||||||| |||||||||||||||||||||| |||||| ||||||||| ||||| ||||||||||    
32731372 aattttgaccccctaatttttccatgtttaggaaaatatgctcttttggccccttatctttaccaaaaagttacgattttggccccttt 32731460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 182 - 264
Target Start/End: Original strand, 3208102 - 3208184
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctca 264  Q
    ||||||||||| | ||||| |||||| ||||   ||||||||||||||||| ||| |||||||||||||||||||||||||||    
3208102 agggaaatatgatattttgaccccttatcttcttaaaaagttgcgattatgacccattttttgggacacgtggcgtcttctca 3208184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 182 - 264
Target Start/End: Complemental strand, 18253068 - 18252986
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctca 264  Q
    ||||||||||| | ||||| |||||| ||||  |||||||||| |||||||||| || |||||||||||||||||||||||||    
18253068 agggaaatatgattttttgaccccttatcttctcaaaaagttgtgattatggccactgttttgggacacgtggcgtcttctca 18252986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 202 - 295
Target Start/End: Original strand, 33895516 - 33895608
Alignment:
202 ccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaaggggactaaaattgc 295  Q
    |||||| ||||||||||||||||| ||||||| ||||||||| ||||||||||||||||||||  | |||| ||||||| ||| | ||||||||    
33895516 ccccttatctttacaaaaagttgcaattatgg-ccctttttttggacacgtggcgtcttctcagaaatttttggatgaaaggggccaaaattgc 33895608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 182 - 339
Target Start/End: Complemental strand, 32400503 - 32400348
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    |||||||||||| |||||| ||  || ||||||||||||||||| |||||| |||||||||||| |||||||| ||||||||| || |||| | |||||     
32400503 agggaaatatgc-cttttgaccatttatctttacaaaaagttgcaattatgaccccttttttggaacacgtggtgtcttctcagcaattttggtatgaaa 32400405  T
282 gggactaaaattgccannnnnnnaatagggagccaaaatcacaatattttgaaacata 339  Q
    ||| ||||| ||||||       ||||||||  ||||||| ||| ||||| |||||||    
32400404 ggg-ctaaagttgccatttttttaatagggaatcaaaatcgcaacattttaaaacata 32400348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 185 - 280
Target Start/End: Complemental strand, 15869517 - 15869422
Alignment:
185 gaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaa 280  Q
    |||||||| ||||||| ||   ||||||  |||||||||||||||||| ||||| ||||||||||||||||| ||||||| || |||||| |||||    
15869517 gaaatatgatcttttgaccatctgtcttctcaaaaagttgcgattatgacccctgttttgggacacgtggcgacttctcagcaattttagaatgaa 15869422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 179 - 264
Target Start/End: Original strand, 16233576 - 16233662
Alignment:
179 tttagggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatgg-ccccttttttgggacacgtggcgtcttctca 264  Q
    |||| ||||||||||||||| | || ||| ||||||||||||||||| ||||||| ||||| ||||||||||||||  |||||||||    
16233576 tttacggaaatatgctctttcgccctcttatctttacaaaaagttgcaattatggccccctgttttgggacacgtgatgtcttctca 16233662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 151 - 267
Target Start/End: Original strand, 132473 - 132589
Alignment:
151 gcaatttttaccccctaatttagccttgtttagggaaatatgctcttttggccccttgtctttac-aaaaagttgcgattatggccccttttttgggaca 249  Q
    |||||||| ||| |||||||| | | |||||||| ||||||||||||  |  ||||| | ||| | |||||||||| ||| |||||||||||||||||||    
132473 gcaattttaaccacctaattt-gtcatgtttaggaaaatatgctcttccgatcccttatttttgcaaaaaagttgcaattttggccccttttttgggaca 132571  T
250 cgtggcgtcttctcaaca 267  Q
    ||||||| ||||||||||    
132572 cgtggcggcttctcaaca 132589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 294
Target Start/End: Complemental strand, 4423211 - 4423100
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||| ||||||| |||||| ||||| |||||| |||||||||| | |||||||||   ||| ||||| |||||||| || |||| ||| ||||    
4423211 agggaaatatgatcttttgaccccttatcttttcaaaaaattgcgattat-gacccttttttttaacatgtggcatcttctcagcaattttgggacgaag 4423113  T
282 gggactaaaattg 294  Q
    ||||| |||||||    
4423112 gggaccaaaattg 4423100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 89 - 264
Target Start/End: Original strand, 8137544 - 8137718
Alignment:
89 aaatgcacttttgaccctttatgtttgtcgtcgtagccattttgacccctaacnnnnnnnnngcaatttttaccccctaatttagccttgtttagggaaa 188  Q
    ||||||||||||| ||| ||||||||| |||| |||| |||||| ||||||||         |||||||  ||||| || ||| |||  |||||||||||    
8137544 aaatgcacttttggccccttatgtttgccgtcatagcaattttggcccctaacaaaaaaat-gcaatttg-accccatatttttgccacgtttagggaaa 8137641  T
189 tatgctcttttggccccttgtctttacaaaa-agttgcgattatggccccttttttgggacacgtggcgtcttctca 264  Q
    |||||||||||| |||||| ||||  ||||| |||||| |||||||| | ||||||| ||||||| ||| |||||||    
8137642 tatgctcttttgcccccttatcttcgcaaaatagttgcaattatggctcattttttgagacacgttgcggcttctca 8137718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 182 - 276
Target Start/End: Complemental strand, 41385672 - 41385578
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttagga 276  Q
    ||||||||||| | ||||| |||||| || |  |||||||||| ||||||||| ||| | |||||||||||||||| ||||||| | ||||||||    
41385672 agggaaatatgattttttgaccccttatcatctcaaaaagttgtgattatggcacctgtcttgggacacgtggcgtattctcaataattttagga 41385578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 166 - 256
Target Start/End: Original strand, 30199469 - 30199560
Alignment:
166 taatttagccttgtttagggaaatatgctcttttggccccttgtctttac--aaaaagttgcgattatggccccttttttgggacacgtggcg 256  Q
    |||||| ||| |||||||| ||||||||||||||  |||||| |||||||  ||||||||| |||| || |||| ||||||||||||||||||    
30199469 taattttgccatgtttaggaaaatatgctcttttaaccccttatctttacaaaaaaagttgtgattttgacccc-tttttgggacacgtggcg 30199560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 239 - 295
Target Start/End: Complemental strand, 21929972 - 21929916
Alignment:
239 tttttgggacacgtggcgtcttctcaacagttttaggatgaaggggactaaaattgc 295  Q
    |||||||||||||||||||||||||| || |||| ||||||||||| | ||||||||    
21929972 tttttgggacacgtggcgtcttctcagcaattttgggatgaagggggccaaaattgc 21929916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 187 - 294
Target Start/End: Original strand, 31268405 - 31268513
Alignment:
187 aatatgctcttttggccccttgtctttacaaaaagttgcgattatgg-ccccttttttgggacacgtggcgtcttctcaacagttttaggatgaagggga 285  Q
    |||||||||||| | ||| || |||||| ||||||||| |||||||  |||||||||||||||| | |||||||||| | || |||||||| ||| |||     
31268405 aatatgctctttagaccctttatctttataaaaagttgtgattatgatccccttttttgggacatgcggcgtcttcttagcaattttaggacgaaagggg 31268504  T
286 ctaaaattg 294  Q
    | |||||||    
31268505 ccaaaattg 31268513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 215 - 272
Target Start/End: Original strand, 1824760 - 1824816
Alignment:
215 caaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagtttt 272  Q
    ||||||||||||| |||||||  | |||||||||||||||||||||||||||| ||||    
1824760 caaaaagttgcgagtatggcct-tgttttgggacacgtggcgtcttctcaacaatttt 1824816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 215 - 272
Target Start/End: Original strand, 1859205 - 1859261
Alignment:
215 caaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagtttt 272  Q
    ||||||||||||| |||||||  | |||||||||||||||||||||||||||| ||||    
1859205 caaaaagttgcgagtatggcct-tgttttgggacacgtggcgtcttctcaacaatttt 1859261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 89 - 137
Target Start/End: Complemental strand, 30199663 - 30199615
Alignment:
89 aaatgcacttttgaccctttatgtttgtcgtcgtagccattttgacccc 137  Q
    |||||||||||||| |||||||||||| ||||||||| |||||| ||||    
30199663 aaatgcacttttgatcctttatgtttgccgtcgtagcaattttggcccc 30199615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 89 - 141
Target Start/End: Complemental strand, 32731513 - 32731461
Alignment:
89 aaatgcacttttgaccctttatgtttgtcgtcgtagccattttgacccctaac 141  Q
    ||||||| |||||  |||||||||||||||||||||  |||||||||||||||    
32731513 aaatgcatttttggtcctttatgtttgtcgtcgtagaaattttgacccctaac 32731461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 196 - 264
Target Start/End: Complemental strand, 41688278 - 41688210
Alignment:
196 ttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctca 264  Q
    ||||| |||||| ||||  |||||||||||||||||| ||| | ||||||||||||| | |||||||||    
41688278 ttttgaccccttatcttctcaaaaagttgcgattatgacccatgttttgggacacgtagtgtcttctca 41688210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 77; Significance: 1e-35; HSPs: 47)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 182 - 339
Target Start/End: Complemental strand, 48907473 - 48907317
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||||| ||||| |||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||| || |||| |||||||     
48907473 agggaaatatgct-ttttgaccccttatctttaaaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcagcaattttgggatgaaa 48907375  T
282 gggactaaaattgccannnnnnnaatagggagccaaaatcacaatattttgaaacata 339  Q
    ||| | ||||||||||       | ||||| | ||||||||||| |||||||||||||    
48907374 ggggccaaaattgccatttttttattagggggtcaaaatcacaacattttgaaacata 48907317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 182 - 297
Target Start/End: Original strand, 4522077 - 4522191
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||||| ||||| |||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| || ||||||||||||     
4522077 agggaaatatgct-ttttgaccccttatctttacaaaaagttgcgattattgccccttttttgggacacgtggcgtcttctcagcaattttaggatgaaa 4522175  T
282 gggactaaaattgcca 297  Q
    ||| | ||||||||||    
4522176 ggggccaaaattgcca 4522191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 182 - 297
Target Start/End: Complemental strand, 26628206 - 26628092
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||||| ||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| |||||||     
26628206 agggaaatatgct-ttttgaccccttatctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcagcaattttgggatgaaa 26628108  T
282 gggactaaaattgcca 297  Q
    ||| | ||||||||||    
26628107 ggggccaaaattgcca 26628092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 182 - 295
Target Start/End: Complemental strand, 3328994 - 3328882
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    |||||||||||| |||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| |||||||     
3328994 agggaaatatgc-cttttgaccccttatctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcagcaatttttggatgaaa 3328896  T
282 gggactaaaattgc 295  Q
    ||| | ||||||||    
3328895 ggggccaaaattgc 3328882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 182 - 339
Target Start/End: Original strand, 13081017 - 13081174
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||||| ||||| |||||| ||||||||||||||||||||||||||||||||||||||||| |||| ||||||||| || |||| ||||||||    
13081017 agggaaatatgct-ttttgaccccttatctttacaaaaagttgcgattatggccccttttttgggacatgtggagtcttctcagcaattttgggatgaag 13081115  T
282 gggactaaaattgcca-nnnnnnnaatagggagccaaaatcacaatattttgaaacata 339  Q
    ||| | ||||||||||        ||||||| ||||||||| ||| |||||||||||||    
13081116 ggggccaaaattgccattttttttaatagggggccaaaatcgcaacattttgaaacata 13081174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 185 - 297
Target Start/End: Complemental strand, 8339118 - 8339007
Alignment:
185 gaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaagggg 284  Q
    |||||||||| ||||| |||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||| || |||| |||||||||||    
8339118 gaaatatgct-ttttgaccccttatctttacaaaaagttgcgattatggcctcttttttgggacacgtggcgtcttctcagcaattttgggatgaagggg 8339020  T
285 actaaaattgcca 297  Q
     | ||||||||||    
8339019 gccaaaattgcca 8339007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 182 - 339
Target Start/End: Complemental strand, 27852932 - 27852777
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||||| ||||| |||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||| || |||||    
27852932 agggaaatatgct-ttttgaccccttatctttacaaaaagttgcgattatggccccttttt-gggacacgtggcgtcttctcaacaattttgggctgaag 27852835  T
282 gggactaaaattgccannnnnnnaatagggagccaaaatcacaatattttgaaacata 339  Q
    ||| | ||||||||||       ||||||| || |||||  ||| |||||||||||||    
27852834 ggggccaaaattgccatttttttaatagggggctaaaattgcaacattttgaaacata 27852777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 177 - 280
Target Start/End: Original strand, 3820999 - 3821102
Alignment:
177 tgtttagggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttagga 276  Q
    |||||||||||||||||||||||| ||| || |||||||||||||||||||||||| |||||||||||||||| |||| ||||||||| || ||||||||    
3820999 tgtttagggaaatatgctcttttgaccctttatctttacaaaaagttgcgattatgaccccttttttgggacatgtggtgtcttctcagcaattttagga 3821098  T
277 tgaa 280  Q
    ||||    
3821099 tgaa 3821102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 182 - 339
Target Start/End: Original strand, 8542733 - 8542890
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||||| ||||| |||||| ||||||||||||||||| |||||||||||||||||| ||||||||||||||||||| || |||| ||||||||    
8542733 agggaaatatgct-ttttgaccccttatctttacaaaaagttgcaattatggccccttttttgtgacacgtggcgtcttctcagcaattttgggatgaag 8542831  T
282 gggactaaaattgcca-nnnnnnnaatagggagccaaaatcacaatattttgaaacata 339  Q
    ||  | ||||||||||        ||||||| ||||||||||||| ||||| |||||||    
8542832 ggagccaaaattgccatttttattaatagggggccaaaatcacaacattttaaaacata 8542890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 182 - 297
Target Start/End: Complemental strand, 28155063 - 28154949
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||||| ||||| || ||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||| || |||| |||||||     
28155063 agggaaatatgct-ttttgacctcttatctttacaaaaagttgcgattatggccctttttttgggacacgtggcgtcttctcagcaatttttggatgaaa 28154965  T
282 gggactaaaattgcca 297  Q
    ||| | ||||||||||    
28154964 ggggccaaaattgcca 28154949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 177 - 339
Target Start/End: Complemental strand, 32960828 - 32960669
Alignment:
177 tgtttagggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttagga 276  Q
    |||||||||||||||||| ||||| |||||| |||||||||||||||||||||||||||  |||||||||||||||||||||||||||  | |||| |||    
32960828 tgtttagggaaatatgct-ttttgaccccttatctttacaaaaagttgcgattatggcct-ttttttgggacacgtggcgtcttctcagtaattttggga 32960731  T
277 tgaaggggactaaaattgccannnnnnnaatagggagccaaaatcacaatattttgaaacata 339  Q
    |||| ||| | ||||||||||       ||||||| ||||||||  ||| |||||||||||||    
32960730 tgaaaggggccaaaattgccatttttttaataggg-gccaaaattgcaacattttgaaacata 32960669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 186 - 294
Target Start/End: Original strand, 22416460 - 22416568
Alignment:
186 aaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaagggga 285  Q
    ||||||||||||||| ||| || ||||||||||||||||| |||||| |||||| ||||||||||||||||||||||||||| |||| ||| |||||||     
22416460 aaatatgctcttttgacccattatctttacaaaaagttgcaattatgaccccttatttgggacacgtggcgtcttctcaacaattttgggacgaaggggg 22416559  T
286 ctaaaattg 294  Q
    | |||||||    
22416560 ccaaaattg 22416568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 182 - 295
Target Start/End: Original strand, 6927593 - 6927705
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||| | ||||| |||||| |||||||||||||||||||||||| |||||||||||||||||||||| |||||| | || |||| |||||||     
6927593 agggaaatatgtt-ttttgaccccttatctttacaaaaagttgcgattatgaccccttttttgggacacgtggcatcttctgagcaattttgggatgaaa 6927691  T
282 gggactaaaattgc 295  Q
    ||| ||||||||||    
6927692 ggggctaaaattgc 6927705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 182 - 339
Target Start/End: Complemental strand, 22500776 - 22500620
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||||| |||||  ||||| | ||||||||||||||||||||||| ||||||||| ||||||||||||||||||||  | |||| |||||||     
22500776 agggaaatatgct-ttttgatcccttatatttacaaaaagttgcgattatggtccctttttttggacacgtggcgtcttctcagaaatttttggatgaaa 22500678  T
282 gggactaaaattgccannnnnnnaatagggagccaaaatcacaatattttgaaacata 339  Q
    ||| |||||||||  |       ||||||| ||||||||  |||||||||||||||||    
22500677 ggggctaaaattgatatttttttaatagggggccaaaattgcaatattttgaaacata 22500620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 196 - 339
Target Start/End: Original strand, 25179714 - 25179855
Alignment:
196 ttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaaggggactaaaattgc 295  Q
    ||||| |||||| ||||||||||||||||||||||||||||||||||||||||||  |||||||||||| || |||| ||||||||||| | | ||||||    
25179714 ttttgaccccttatctttacaaaaagttgcgattatggccccttttttgggacac--ggcgtcttctcagcaattttgggatgaagggggccataattgc 25179811  T
296 cannnnnnnaatagggagccaaaatcacaatattttgaaacata 339  Q
    ||       |||| || ||||| ||| ||| |||||||||||||    
25179812 catttttttaataaggggccaatatcgcaacattttgaaacata 25179855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 182 - 280
Target Start/End: Original strand, 3781001 - 3781098
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaa 280  Q
    ||||||||||||| ||||| ||| || ||||||||||||||||||| |||| ||||||||||||||||||||| ||||||||| || ||||||||||||    
3781001 agggaaatatgct-ttttgaccctttatctttacaaaaagttgcgaatatgaccccttttttgggacacgtggtgtcttctcagcaattttaggatgaa 3781098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 108 - 264
Target Start/End: Complemental strand, 24312922 - 24312763
Alignment:
108 tatgtttgtcgtcgtagccattttgacccc-taacnnnnnnnnngcaatttttaccccctaatttagccttgtttagggaaatatgctcttttggcccct 206  Q
    |||||||||||||||||| |||||| |||| ||||         |||||||| ||||| |||||| ||| |||||||| ||||||||||||||| ||| |    
24312922 tatgtttgtcgtcgtagcaattttggccccctaacaaaaacaatgcaattttgaccccttaattttgccatgtttaggaaaatatgctcttttgcccctt 24312823  T
207 tgtctttacaaaa-agttgcgattatgg-ccccttttttgggacacgtggcgtcttctca 264  Q
    | ||||||||||| |||||| ||||||| |||||||||||||||| |||||| |||||||    
24312822 tatctttacaaaatagttgcaattatggcccccttttttgggacatgtggcgacttctca 24312763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 182 - 294
Target Start/End: Complemental strand, 30155326 - 30155215
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||| | ||||| |||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||| || || ||||  ||||||     
30155326 agggaaatatgtt-ttttgaccccttatctttacaaaaagttgcgattatggccccttttttgggacacatggcgtcttcgcagcaattttttgatgaaa 30155228  T
282 gggactaaaattg 294  Q
    ||| | |||||||    
30155227 ggggccaaaattg 30155215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 203 - 345
Target Start/End: Complemental strand, 25022824 - 25022682
Alignment:
203 cccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaaggggactaaaattgccannnnn 302  Q
    ||||| |||||||||||||||||||||||| |||||||| ||||||||||||| |||||| | || |||| ||||||| ||| | |||||||| |         
25022824 cccttatctttacaaaaagttgcgattatgaccccttttctgggacacgtggcatcttctgagcaattttgggatgaaaggggccaaaattgctattttt 25022725  T
303 nnaatagggagccaaaatcacaatattttgaaacatattgggc 345  Q
      || |||| ||||||||| ||||||| |||||||||| ||||    
25022724 ttaacagggggccaaaatcgcaatattatgaaacatatggggc 25022682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 183 - 264
Target Start/End: Complemental strand, 26127086 - 26127006
Alignment:
183 gggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctca 264  Q
    |||||||||||| |||||||||||| ||||||||||||||||||||||||||| ||||||| ||||  ||||||||||||||    
26127086 gggaaatatgct-ttttggccccttatctttacaaaaagttgcgattatggcctctttttttggacttgtggcgtcttctca 26127006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 161 - 264
Target Start/End: Complemental strand, 32463623 - 32463519
Alignment:
161 ccccctaatttagccttgtttagggaaatatgctcttttggccccttgtctttacaaaaa-gttgcgattatggccccttttttgggacacgtggcgtct 259  Q
    ||||||||||| ||| ||||||||||||||   ||||||| |||||| |||||||||||| ||||||||| || ||| ||||||||||||||||||| ||    
32463623 ccccctaattttgccatgtttagggaaatacagtcttttgaccccttatctttacaaaaaagttgcgattttgaccctttttttgggacacgtggcggct 32463524  T
260 tctca 264  Q
    |||||    
32463523 tctca 32463519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 209 - 295
Target Start/End: Complemental strand, 22447895 - 22447809
Alignment:
209 tctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaaggggactaaaattgc 295  Q
    ||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||  | |||| ||||||| ||| | ||||||||    
22447895 tctttacaaaaagttgcgattatggcccctttttttggatacgtggcgtcttctcagaaatttttggatgaaagggtccaaaattgc 22447809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 182 - 280
Target Start/End: Complemental strand, 23428800 - 23428703
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaa 280  Q
    ||||||||||| | ||||| |||||| |||||||||||||||||||||||| |||||||| ||||||||||||| |||||| | || |||| |||||||    
23428800 agggaaatatgtt-ttttgaccccttatctttacaaaaagttgcgattatgaccccttttctgggacacgtggcatcttctgagcaattttgggatgaa 23428703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 182 - 264
Target Start/End: Complemental strand, 34878710 - 34878629
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctca 264  Q
    ||||||||||||| |||||  ||||| ||||||||||||||| | |||||||| |||||||||||||||||||||||||||||    
34878710 agggaaatatgct-ttttgatcccttatctttacaaaaagtttcaattatggcaccttttttgggacacgtggcgtcttctca 34878629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 182 - 295
Target Start/End: Complemental strand, 28173910 - 28173798
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||| | ||||| |||||| |||||||||||||||||||||||| |||||||| ||||||||||||| |||||  | || |||| |||||||     
28173910 agggaaatatgtt-ttttgaccccttatctttacaaaaagttgcgattatgaccccttttctgggacacgtggcatcttccgagcaattttgggatgaaa 28173812  T
282 gggactaaaattgc 295  Q
    ||| | ||||||||    
28173811 ggggccaaaattgc 28173798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 180 - 267
Target Start/End: Original strand, 2683068 - 2683156
Alignment:
180 ttagggaaatatgctcttttggccccttgtctttacaaaaag-ttgcgattatggccccttttttgggacacgtggcgtcttctcaaca 267  Q
    ||||| |||||||||||||| | ||||| ||||||||||||  |||||||||||||||||||||||||||||| || | ||||||||||    
2683068 ttaggaaaatatgctcttttcgtcccttatctttacaaaaaaattgcgattatggccccttttttgggacacgcggtggcttctcaaca 2683156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 196 - 255
Target Start/End: Complemental strand, 26633527 - 26633468
Alignment:
196 ttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggc 255  Q
    ||||| |||||| |||||||||||||||||||||||||||||||||||||| ||||||||    
26633527 ttttgaccccttatctttacaaaaagttgcgattatggccccttttttggggcacgtggc 26633468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 182 - 280
Target Start/End: Original strand, 20001832 - 20001929
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaa 280  Q
    ||||||||||| ||| ||| |||||| | ||  ||||||||||||| |||||||||| |||||| ||||||||||||||||||||| |||| |||||||    
20001832 agggaaatatgatctcttg-ccccttatattctcaaaaagttgcgactatggcccctgttttggaacacgtggcgtcttctcaacaattttgggatgaa 20001929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 151 - 264
Target Start/End: Complemental strand, 48743347 - 48743231
Alignment:
151 gcaatttttaccccctaatttagccttgtttagggaaatatgctcttttggccccttgtctttaca---aaaagttgcgattatggccccttttttggga 247  Q
    |||||||| |||||||||||| ||| ||||||||||||||   ||||||| ||| || ||||||||   |||||||| |||| || ||||||||||||||    
48743347 gcaattttgaccccctaattttgccatgtttagggaaatagagtcttttgacccattatctttacaaaaaaaagttgtgattttgaccccttttttggga 48743248  T
248 cacgtggcgtcttctca 264  Q
    || |||||| |||||||    
48743247 catgtggcggcttctca 48743231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 182 - 295
Target Start/End: Original strand, 10743530 - 10743642
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||| | ||||| |||||| |||||||||||||||||||||||| |||||||| |||| |||||||| |||| | | || |||| |||||||     
10743530 agggaaatatgtt-ttttgaccccttatctttacaaaaagttgcgattatgaccccttttctgggtcacgtggcatcttttgagcaattttgggatgaaa 10743628  T
282 gggactaaaattgc 295  Q
    ||| | ||||||||    
10743629 ggggccaaaattgc 10743642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 183 - 264
Target Start/End: Complemental strand, 26177136 - 26177056
Alignment:
183 gggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctca 264  Q
    |||||||||||| ||||||| | || ||||||||||||||||||||||||||| ||||||||||||  ||||| ||||||||    
26177136 gggaaatatgct-ttttggctcattatctttacaaaaagttgcgattatggcctcttttttgggacttgtggcttcttctca 26177056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 216 - 264
Target Start/End: Complemental strand, 40836326 - 40836278
Alignment:
216 aaaaagttgcgattatggccccttttttgggacacgtggcgtcttctca 264  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||||    
40836326 aaaaagttgcgattatggccccttttttgggacacgtggcggcttctca 40836278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 182 - 264
Target Start/End: Complemental strand, 33279766 - 33279685
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctca 264  Q
    |||||||||||||||||||  ||||| | ||||||||| ||| |||||||| ||| ||||||| |||||||||||||||||||    
33279766 agggaaatatgctcttttgatcccttatatttacaaaa-gttacgattatgaccctttttttgagacacgtggcgtcttctca 33279685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 198 - 264
Target Start/End: Original strand, 43668566 - 43668632
Alignment:
198 ttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctca 264  Q
    |||| ||||| | |||||||||||||||||||||| ||||| |||||||||| ||||||||||||||    
43668566 ttggtcccttatttttacaaaaagttgcgattatgacccctgttttgggacatgtggcgtcttctca 43668632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 196 - 295
Target Start/End: Complemental strand, 46673216 - 46673116
Alignment:
196 ttttggccccttgtctttacaaaaa-gttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaaggggactaaaattg 294  Q
    ||||| |||||| |||||||||||| |||||||||||| |||||||| | ||||||||||| |||||| | || |||| ||||||| ||| | |||||||    
46673216 ttttgaccccttatctttacaaaaaagttgcgattatgaccccttttctaggacacgtggcatcttctgagcaattttgggatgaaaggggccaaaattg 46673117  T
295 c 295  Q
    |    
46673116 c 46673116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 209 - 272
Target Start/End: Complemental strand, 20626877 - 20626814
Alignment:
209 tctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagtttt 272  Q
    ||||||||||||||| |||||||| | |||||||||||||| |||||||||||| |||| ||||    
20626877 tctttacaaaaagttacgattatgactccttttttgggacatgtggcgtcttcttaacaatttt 20626814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 182 - 297
Target Start/End: Original strand, 36311273 - 36311388
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    |||||||||||   ||||  |||||| ||||  |||| ||||||||||| ||||| | |||||||||||||||| ||||||||||| |||| ||| |||     
36311273 agggaaatatgacattttaaccccttatcttctcaaatagttgcgattacggcccatattttgggacacgtggcttcttctcaacaattttgggacgaaa 36311372  T
282 gggactaaaattgcca 297  Q
    ||| | ||||||||||    
36311373 ggggccaaaattgcca 36311388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 184 - 280
Target Start/End: Complemental strand, 35201175 - 35201079
Alignment:
184 ggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaa 280  Q
    ||||||||| | ||||| |||||| ||||  ||||||||| |||| ||||| ||| |||| ||||| ||||| ||||||||||| |||| |||||||    
35201175 ggaaatatgatattttgaccccttatcttctcaaaaagttacgatcatggctcctgttttaggacatgtggcatcttctcaacaattttgggatgaa 35201079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 184 - 295
Target Start/End: Original strand, 1743373 - 1743484
Alignment:
184 ggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaaggg 283  Q
    |||||| || ||||||| |||||| ||||  |||||||||||||| | ||||  | |||||||||| |||||||||||||| || ||||  ||  || ||    
1743373 ggaaatgtgatcttttgaccccttatcttctcaaaaagttgcgataagggccattgttttgggacatgtggcgtcttctcagcaattttgtgacaaaagg 1743472  T
284 gactaaaattgc 295  Q
    ||||||||||||    
1743473 gactaaaattgc 1743484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 185 - 280
Target Start/End: Original strand, 33105066 - 33105161
Alignment:
185 gaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaa 280  Q
    |||||||| | |||||  ||||| ||||  ||||||||| |||||||  ||| | ||||||||||||||||||||||||| || |||| |||||||    
33105066 gaaatatgttattttgatcccttttcttcccaaaaagtttcgattatttcccatgttttgggacacgtggcgtcttctcatcaattttgggatgaa 33105161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 211 - 273
Target Start/End: Original strand, 36033738 - 36033800
Alignment:
211 tttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagtttta 273  Q
    ||||||||||||||| ||| ||||||||   |||||||||||||||||||||||  |||||||    
36033738 tttacaaaaagttgcaattttggcccctgagttgggacacgtggcgtcttctcattagtttta 36033800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 202 - 264
Target Start/End: Complemental strand, 46387743 - 46387681
Alignment:
202 ccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctca 264  Q
    |||||| ||||| |||||| | || ||||||||||||||||||| |||| |||||||||||||    
46387743 ccccttatctttccaaaaactagcaattatggccccttttttggaacacatggcgtcttctca 46387681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 182 - 262
Target Start/End: Original strand, 48860825 - 48860905
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggcccctttt-ttgggacacgtggcgtcttct 262  Q
    ||||||||||| | ||||| |||||| ||||||||||||||||||||||||  ||||||| | ||| |||||||| ||||||    
48860825 agggaaatatgtt-ttttgaccccttatctttacaaaaagttgcgattatgatcccttttctgggggcacgtggcatcttct 48860905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 180 - 263
Target Start/End: Complemental strand, 9662431 - 9662347
Alignment:
180 ttagggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggcc-ccttttttgggacacgtggcgtcttctc 263  Q
    |||||||||||  |||||||| |||||| ||||||||||||||||| |   ||||| ||| |||| ||||||||||| |||||||    
9662431 ttagggaaataatctcttttgaccccttatctttacaaaaagttgcaacattggcctcctgttttaggacacgtggcatcttctc 9662347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 216 - 264
Target Start/End: Complemental strand, 31039125 - 31039077
Alignment:
216 aaaaagttgcgattatggccccttttttgggacacgtggcgtcttctca 264  Q
    |||||||||||||||| ||||||||||| | ||| ||||||||||||||    
31039125 aaaaagttgcgattatagccccttttttagaacatgtggcgtcttctca 31039077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 215 - 294
Target Start/End: Original strand, 23320516 - 23320594
Alignment:
215 caaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaaggggactaaaattg 294  Q
    ||||||||||| ||||||||||| ||||||||||| |||||||||| ||| || |||| ||| ||| ||| | |||||||    
23320516 caaaaagttgctattatggcccc-tttttgggacatgtggcgtcttttcagcaattttgggacgaaaggggccaaaattg 23320594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 179 - 273
Target Start/End: Original strand, 25310191 - 25310286
Alignment:
179 tttagggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggcc-ccttttttgggacacgtggcgtcttctcaacagtttta 273  Q
    |||||||||||| ||| ||||||||  || |||||||||||| ||||  || ||||| ||| |||| ||||| |||| ||||||||||||| ||||    
25310191 tttagggaaataagctattttggccatttatctttacaaaaaattgcagttttggcctcctattttaggacatgtggtgtcttctcaacagcttta 25310286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 76; Significance: 5e-35; HSPs: 36)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 182 - 297
Target Start/End: Original strand, 18791480 - 18791594
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||||| ||||| |||||  ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||| ||||||||    
18791480 agggaaatatgct-ttttgacccctcatctttacaaaaagttgcgattatggccccttttttaggacacgtggcgtcttctcaacaattttgggatgaag 18791578  T
282 gggactaaaattgcca 297  Q
    ||| | ||||||||||    
18791579 ggggccaaaattgcca 18791594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 182 - 297
Target Start/End: Complemental strand, 35102672 - 35102558
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||||| ||||| |||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||| || |||| ||||||||    
35102672 agggaaatatgct-ttttgaccccttatctttacaaaaagttgcaattatggccccttttttgggacacgtggcgtcttctcagcaattttgggatgaag 35102574  T
282 gggactaaaattgcca 297  Q
    ||| | ||||||||||    
35102573 ggggccaaaattgcca 35102558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 177 - 264
Target Start/End: Complemental strand, 20863915 - 20863828
Alignment:
177 tgtttagggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctca 264  Q
    |||||||| || |||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
20863915 tgtttaggaaattatgctcttttgaccccttatctttacaaaaagttgcgattatggccccttttttgggacacatggcgtcttctca 20863828  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 182 - 284
Target Start/End: Original strand, 24603484 - 24603585
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||||| ||||| |||||| ||||||||||||||||||||||||||||||||||| |||||| ||||||||||||| || |||| ||||||||    
24603484 agggaaatatgct-ttttgaccccttatctttacaaaaagttgcgattatggcccctttttttggacacatggcgtcttctcagcaattttgggatgaag 24603582  T
282 ggg 284  Q
    |||    
24603583 ggg 24603585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 182 - 294
Target Start/End: Original strand, 32451849 - 32451960
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||||| ||||| |||||| |||||||||||||||||||||||| ||||||||||| |||| ||||||||||||||||| |||| |||||||     
32451849 agggaaatatgct-ttttgaccccttatctttacaaaaagttgcgattatgaccccttttttgagacatgtggcgtcttctcaacaatttttggatgaaa 32451947  T
282 gggactaaaattg 294  Q
    ||| | |||||||    
32451948 ggggccaaaattg 32451960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 182 - 297
Target Start/End: Original strand, 31210917 - 31211031
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||||| ||||| |||||| ||||||||||||||||||||||| || ||||||||||||||||||| ||||||||| || |||| |||||||     
31210917 agggaaatatgct-ttttgaccccttatctttacaaaaagttgcgattatagcaccttttttgggacacgtggtgtcttctcagcaattttgggatgaaa 31211015  T
282 gggactaaaattgcca 297  Q
    ||| | ||||||||||    
31211016 ggggccaaaattgcca 31211031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 182 - 264
Target Start/End: Original strand, 25819807 - 25819888
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctca 264  Q
    ||||||||||||| ||||| |||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
25819807 agggaaatatgct-ttttgaccccttatctttacaaaaagttgcgattatgaccccttttttgggacacgtggcgtcttctca 25819888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 196 - 284
Target Start/End: Complemental strand, 26710475 - 26710387
Alignment:
196 ttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaagggg 284  Q
    ||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||  | |||| |||||||||||    
26710475 ttttgaccccttatctttacaaaaagttgcgattatggccccttttttgggacacgtggcatcttctcagtaattttgggatgaagggg 26710387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 182 - 339
Target Start/End: Original strand, 34834048 - 34834204
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||| | ||||| ||| || ||||||||||||||| | |||||||||||||||||||||||||||||||||||||| || |||| ||||||||    
34834048 agggaaatatgtt-ttttgacccgttatctttacaaaaagttacaattatggccccttttttgggacacgtggcgtcttctcagcaattttgggatgaag 34834146  T
282 gggactaaaattgccannnnnnnaatagggagccaaaatcacaatattttgaaacata 339  Q
     || | ||||||||||       ||||||  | ||||||| ||||||||| |||||||    
34834147 tgggccaaaattgccatttttttaataggaggtcaaaatcgcaatattttaaaacata 34834204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 177 - 264
Target Start/End: Complemental strand, 23124907 - 23124820
Alignment:
177 tgtttagggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctca 264  Q
    |||||||| ||||||||||||||| |||||| |||||||||||||||||||||||| |||||||||  ||||| ||||||||||||||    
23124907 tgtttaggaaaatatgctcttttgaccccttatctttacaaaaagttgcgattatgacccctttttgaggacatgtggcgtcttctca 23124820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 182 - 272
Target Start/End: Original strand, 22269529 - 22269618
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagtttt 272  Q
    ||||||||||| | ||||| |||||| |||||||||||||||| | |||||||||||||||||||||||||||||||||||||||| ||||    
22269529 agggaaatatgtt-ttttgaccccttatctttacaaaaagttgtgtttatggccccttttttgggacacgtggcgtcttctcaacaatttt 22269618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 182 - 295
Target Start/End: Complemental strand, 14572359 - 14572247
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||||| ||||| |||||| |||||| ||||||||||||||||||||| |||||||||||| ||||| |||||||| || |||| |||||||     
14572359 agggaaatatgct-ttttgaccccttatctttataaaaagttgcgattatggccctttttttgggacatgtggcatcttctcagcaatttttggatgaaa 14572261  T
282 gggactaaaattgc 295  Q
    ||| | ||||||||    
14572260 ggggccaaaattgc 14572247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 196 - 297
Target Start/End: Original strand, 24051144 - 24051245
Alignment:
196 ttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaaggggactaaaattgc 295  Q
    ||||| |||||| | |||||||||||||||||||||| || |||||||||||||||||||||||||||| || |||| |||||||  || | ||||||||    
24051144 ttttgaccccttatatttacaaaaagttgcgattatgacctcttttttgggacacgtggcgtcttctcatcaattttgggatgaaatgggccaaaattgc 24051243  T
296 ca 297  Q
    ||    
24051244 ca 24051245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 182 - 294
Target Start/End: Complemental strand, 4597586 - 4597475
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||| | ||||| |||||| ||||||||||||||||| ||||||||||||||||||||||| |||||||||| |||  | |||| || |||||    
4597586 agggaaatatgtt-ttttgaccccttatctttacaaaaagttgcaattatggccccttttttgggacatgtggcgtcttttcagtaattttgggttgaag 4597488  T
282 gggactaaaattg 294  Q
    ||| | |||||||    
4597487 ggggccaaaattg 4597475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 179 - 272
Target Start/End: Complemental strand, 11661105 - 11661011
Alignment:
179 tttagggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggcccctt-ttttgggacacgtggcgtcttctcaacagtttt 272  Q
    |||| ||||||||||||||||  |||||| ||||||||||||||||||||| ||||||||| |||||||||| |||| ||||||| | |||||||    
11661105 tttaaggaaatatgctctttttcccccttatctttacaaaaagttgcgattttggccccttattttgggacatgtggtgtcttctaagcagtttt 11661011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 182 - 295
Target Start/End: Complemental strand, 18749277 - 18749165
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||||| ||||| |||||| |||||||||||||||| ||||||| |||||||||||||||| ||||| |||||| | || |||| | |||||     
18749277 agggaaatatgct-ttttgaccccttatctttacaaaaagttgtgattatgtccccttttttgggacatgtggcttcttcttatcaatttttgtatgaaa 18749179  T
282 gggactaaaattgc 295  Q
    ||| | ||||||||    
18749178 ggggccaaaattgc 18749165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 182 - 254
Target Start/End: Original strand, 8412881 - 8412952
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtgg 254  Q
    ||||||||||| | ||||| |||||| |||||||||||||||||||||||| |||||||||||||||||||||    
8412881 agggaaatatgtt-ttttgaccccttatctttacaaaaagttgcgattatgaccccttttttgggacacgtgg 8412952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 151 - 267
Target Start/End: Original strand, 19176468 - 19176584
Alignment:
151 gcaatttttaccccctaatttagccttgtttagggaaatatgctcttttggccccttgtctttac-aaaaagttgcgattatggccccttttttgggaca 249  Q
    |||||||| ||||| |||||| ||| |||||||||||||||||| ||||| | | || ||||||| |||||||||||| ||| | ||| |||||||||||    
19176468 gcaattttgaccccataattttgccatgtttagggaaatatgctattttgacacattatctttacaaaaaagttgcgactat-gacccatttttgggaca 19176566  T
250 cgtggcgtcttctcaaca 267  Q
    ||||||| ||||| ||||    
19176567 cgtggcggcttctaaaca 19176584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 182 - 297
Target Start/End: Complemental strand, 12291599 - 12291484
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||| ||||||| ||| || ||||  |||||||||||||||||| |  || ||||||||||| |||||||||||||||| ||||  || |||     
12291599 agggaaatatgatcttttgaccctttatcttctcaaaaagttgcgattatgacatctgttttgggacacatggcgtcttctcaacaattttgtgacgaaa 12291500  T
282 gggactaaaattgcca 297  Q
     |||| ||||||||||    
12291499 tggaccaaaattgcca 12291484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 182 - 264
Target Start/End: Original strand, 9241774 - 9241856
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctca 264  Q
    ||||||||||| ||||||| |||||| ||||  |||||||||||||||||| || || ||||||||||| ||||| |||||||    
9241774 agggaaatatgatcttttgaccccttatcttctcaaaaagttgcgattatgccctctgttttgggacacatggcgccttctca 9241856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 203 - 297
Target Start/End: Original strand, 15298628 - 15298721
Alignment:
203 cccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaaggggactaaaattgcca 297  Q
    ||||| |||||||||||||||||||||||||  |||||||||||||| |||||||||||||| || ||||  ||| |||||  | ||||||||||    
15298628 cccttatctttacaaaaagttgcgattatgg-tccttttttgggacaagtggcgtcttctcagcaattttgagataaagggagccaaaattgcca 15298721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 182 - 272
Target Start/End: Original strand, 26240079 - 26240169
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagtttt 272  Q
    ||||||||||| ||||||| |||||| ||||   |||||||||| |||||| |||||||| | |||||||||||||||||||  |||||||    
26240079 agggaaatatgatcttttgaccccttatcttctaaaaaagttgcaattatgaccccttttataggacacgtggcgtcttctcggcagtttt 26240169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 182 - 294
Target Start/End: Original strand, 3118802 - 3118913
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||| | ||||| || ||| |||||||||||| ||||||||||| |||||||| ||||||||||| | |||||| | || |||| |||||||     
3118802 agggaaatatgtt-ttttgacctcttatctttacaaaaatttgcgattatgaccccttttctgggacacgtgacatcttctgatcaattttgggatgaaa 3118900  T
282 gggactaaaattg 294  Q
    ||| | |||||||    
3118901 ggggccaaaattg 3118913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 186 - 294
Target Start/End: Original strand, 2636903 - 2637012
Alignment:
186 aaatatgctcttttggccccttgtctttacaaaaagttgcgattatg-gccccttttttgggacacgtggcgtcttctcaacagttttaggatgaagggg 284  Q
    ||||||||| ||||| |||||| | ||||||||||||||||||||||  ||||||| | || ||| |||||||||||||  || |||||||| ||| |||    
2636903 aaatatgctattttgaccccttatttttacaaaaagttgcgattatgaccccctttctaggaacatgtggcgtcttctcttcaattttaggacgaaaggg 2637002  T
285 actaaaattg 294  Q
     | |||||||    
2637003 gccaaaattg 2637012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 185 - 294
Target Start/End: Original strand, 34528273 - 34528382
Alignment:
185 gaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaagggg 284  Q
    |||||||| ||||||| |||||| ||||  ||||||||||||||||||||  || |||||||||| |||  ||||||||| || |||| ||| ||| |||    
34528273 gaaatatgatcttttgaccccttatcttctcaaaaagttgcgattatggcgactgttttgggacatgtgatgtcttctcagcaattttgggacgaaaggg 34528372  T
285 actaaaattg 294  Q
     | |||||||    
34528373 gccaaaattg 34528382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 182 - 232
Target Start/End: Original strand, 14195682 - 14195732
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatg 232  Q
    ||||||||||| |||||| ||||||| | ||||||||||||||||||||||    
14195682 agggaaatatggtcttttagccccttatttttacaaaaagttgcgattatg 14195732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 182 - 239
Target Start/End: Complemental strand, 4013848 - 4013791
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggcccctt 239  Q
    ||||||||||| ||||||| |||||| ||||  ||||| |||||||||||||||||||    
4013848 agggaaatatgatcttttgaccccttatcttctcaaaatgttgcgattatggcccctt 4013791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 182 - 227
Target Start/End: Original strand, 4371020 - 4371065
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcga 227  Q
    |||||||||||||| |||| |||||| |||||||||||||||||||    
4371020 agggaaatatgctcctttgaccccttatctttacaaaaagttgcga 4371065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 242
Target Start/End: Complemental strand, 19282392 - 19282333
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttt 242  Q
    ||||||||||||  ||||| |||||| ||||| |||||||||||||||||| |||||||||    
19282392 agggaaatatgca-ttttgaccccttatcttttcaaaaagttgcgattatgaccccttttt 19282333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 185 - 264
Target Start/End: Complemental strand, 24615872 - 24615793
Alignment:
185 gaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggcccct-tttttgggacacgtggcgtcttctca 264  Q
    |||||||||| ||||| ||| || ||||||| |||||||||||||||| ||| | ||||||||||| ||||||| ||||||    
24615872 gaaatatgct-ttttgacccattctctttactaaaagttgcgattatgacccttatttttgggacatgtggcgttttctca 24615793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 185 - 264
Target Start/End: Original strand, 29365416 - 29365496
Alignment:
185 gaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttt-tttgggacacgtggcgtcttctca 264  Q
    |||||| ||||||||||||| || ||||||||||||||||| ||| |||||||    ||||| |||| |||||||||||||    
29365416 gaaataagctcttttggccctttatctttacaaaaagttgcaattttggccccccgctttggcacacatggcgtcttctca 29365496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 203 - 294
Target Start/End: Complemental strand, 22968316 - 22968226
Alignment:
203 cccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaaggggactaaaattg 294  Q
    ||||| ||||||||||||||||||||||| | ||||||| || |||||||| | |||||| | || |||| ||||||| ||| | |||||||    
22968316 cccttatctttacaaaaagttgcgattat-gacccttttctgagacacgtgacatcttctgagcaattttgggatgaaaggggccaaaattg 22968226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 203 - 294
Target Start/End: Original strand, 23820077 - 23820167
Alignment:
203 cccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaaggggactaaaattg 294  Q
    ||||| ||||||||||||||||||||||| | ||||||| || |||||||| | |||||| | || |||| ||||||| ||| | |||||||    
23820077 cccttatctttacaaaaagttgcgattat-gacccttttctgagacacgtgacatcttctgagcaattttgggatgaaaggggccaaaattg 23820167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 177 - 263
Target Start/End: Complemental strand, 24085071 - 24084984
Alignment:
177 tgtttagggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggcccct-tttttgggacacgtggcgtcttctc 263  Q
    |||||||| ||||||| | |||||| || || |||||| |||||||| ||||| || ||||| |||||||||||| || |||||||||    
24085071 tgtttaggaaaatatgttattttggtcctttatctttataaaaagttacgattctgacccctgtttttgggacacatgccgtcttctc 24084984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #35
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 179 - 232
Target Start/End: Original strand, 9620538 - 9620591
Alignment:
179 tttagggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatg 232  Q
    ||||| |||||| |||||||||||||||| | |||||||||| ||| |||||||    
9620538 tttagagaaataagctcttttggccccttatttttacaaaaaattgtgattatg 9620591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #36
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 196 - 264
Target Start/End: Original strand, 12293713 - 12293782
Alignment:
196 ttttggccccttgtctttacaaaaagttgcgattatggcccctt-ttttgggacacgtggcgtcttctca 264  Q
    |||||||||  | ||||||||||||||||||||| |  |||| | ||||||||||||| |||||||||||    
12293713 ttttggccctctatctttacaaaaagttgcgattttaaccccctgttttgggacacgtagcgtcttctca 12293782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 76; Significance: 5e-35; HSPs: 36)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 182 - 297
Target Start/End: Original strand, 15735187 - 15735301
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||| | ||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||     
15735187 agggaaatatg-tattttgaccccttatctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacaattttgggatgaaa 15735285  T
282 gggactaaaattgcca 297  Q
    ||| | ||||||||||    
15735286 ggggccaaaattgcca 15735301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 182 - 339
Target Start/End: Original strand, 2986809 - 2986966
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||||| ||||| |||||| ||||||||||||||||||||||||||||||||||| |||||| ||||||||||||| || |||| ||||||||    
2986809 agggaaatatgct-ttttgaccccttatctttacaaaaagttgcgattatggcccctttttttggacacatggcgtcttctcagcaattttgggatgaag 2986907  T
282 gggactaaaattgcca-nnnnnnnaatagggagccaaaatcacaatattttgaaacata 339  Q
    ||| | ||||||||||        ||||||| ||||||||| ||| |||||||||||||    
2986908 ggggccaaaattgccattttttttaatagggggccaaaatcgcaacattttgaaacata 2986966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 182 - 295
Target Start/End: Original strand, 17368339 - 17368451
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||||| ||||| |||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||| |||||||     
17368339 agggaaatatgct-ttttgaccccttatctttacaaaaagttgcaattatggccccttttttgggacacgtggcgtcttctcaacattttttggatgaaa 17368437  T
282 gggactaaaattgc 295  Q
    ||| | ||||||||    
17368438 ggggccaaaattgc 17368451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 182 - 339
Target Start/End: Original strand, 9787682 - 9787837
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||||| ||||| |||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||| || |||| |||||||     
9787682 agggaaatatgct-ttttgaccccttatctttacaaaaagttacgattatggccccttttttgggacacgtggcgtcttctcagcaatttttggatgaaa 9787780  T
282 gggactaaaattgccannnnnnnaatagggagccaaaatcacaatattttgaaacata 339  Q
    ||| | ||||||| ||       ||||||| ||||||||  |||||||||||||||||    
9787781 ggggccaaaattgtca-ttttttaatagggggccaaaattgcaatattttgaaacata 9787837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 182 - 297
Target Start/End: Original strand, 11176030 - 11176144
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||||| ||||| |||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||| || |||| |||||||     
11176030 agggaaatatgct-ttttgaccccttatctttacaaaaagttgtgattatggccccttttttgggacacgtggcgtcttctcagcaattttgggatgaaa 11176128  T
282 gggactaaaattgcca 297  Q
    ||||  ||||||||||    
11176129 gggatcaaaattgcca 11176144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 180 - 295
Target Start/End: Complemental strand, 18538011 - 18537897
Alignment:
180 ttagggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatga 279  Q
    ||||||||||||||| ||||| |||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||| || |||| ||||||    
18538011 ttagggaaatatgct-ttttgaccccttatctttacaaaaagttgcaattatggccccttttttgggacacgtggcgtcttctcagcaatttttggatga 18537913  T
280 aggggactaaaattgc 295  Q
    | ||| | ||||||||    
18537912 aaggggccaaaattgc 18537897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 185 - 295
Target Start/End: Original strand, 38716319 - 38716428
Alignment:
185 gaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaagggg 284  Q
    |||||||||| ||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| ||||||| |||    
38716319 gaaatatgct-ttttgaccccttatctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcagcaatttttggatgaaaggg 38716417  T
285 actaaaattgc 295  Q
     | ||||||||    
38716418 gccaaaattgc 38716428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 203 - 295
Target Start/End: Complemental strand, 25298962 - 25298870
Alignment:
203 cccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaaggggactaaaattgc 295  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||| ||||||||||| | ||||||||    
25298962 cccttatctttacaaaaagttgcgattatggccccttttttgggacacgtggcatcttctcaacaattttgggatgaagggggccaaaattgc 25298870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 182 - 339
Target Start/End: Complemental strand, 30714455 - 30714299
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||||| ||||| ||| || |||||||||||||||| |||||||||||||||||||||||| |||||||||||||| || |||| |||||||     
30714455 agggaaatatgct-ttttgacccgttatctttacaaaaagttgtgattatggccccttttttgggacatgtggcgtcttctcagcaattttgggatgaaa 30714357  T
282 gggactaaaattgccannnnnnnaatagggagccaaaatcacaatattttgaaacata 339  Q
    ||| | ||||||||||       ||||||| ||||||||| ||| ||||| |||||||    
30714356 ggggccaaaattgccatttttttaatagggggccaaaatcgcaacattttaaaacata 30714299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 89 - 267
Target Start/End: Complemental strand, 19619049 - 19618870
Alignment:
89 aaatgcacttttgaccctttatgtttgtcgtcgtagccattttga-cccctaacnnnnnnnnngcaatttttaccccctaatttagccttgtttagggaa 187  Q
    ||||||||||||| |||  ||| |||||||| ||||||||||||| ||||||||         ||||||||||||||||||||| |||| || |||||||    
19619049 aaatgcacttttggccccctatatttgtcgt-gtagccattttgatcccctaacgaaaaaaatgcaatttttaccccctaattttgcctcgtgtagggaa 19618951  T
188 atatgctcttttggccccttgtctttaca-aaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaaca 267  Q
    ||||||||||||  |||||| |||||||| |||||||| | ||||| |||||||||||||||| |||||| || |||||||    
19618950 atatgctcttttaaccccttatctttacaaaaaagttgtgtttatgaccccttttttgggacatgtggcggctgctcaaca 19618870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 89 - 267
Target Start/End: Complemental strand, 22699124 - 22698944
Alignment:
89 aaatgcacttttgaccctttatgtttgtcgtcgtagccattttgac-ccctaacnnnnnnnnngcaatttttaccccctaatttagccttgtttagggaa 187  Q
    |||||||||||||||||  |||||||| ||||||||| |||||||| |||||||         |||||||| |||||||||||| | | |||||||| ||    
22699124 aaatgcacttttgaccccctatgtttgccgtcgtagcaattttgactccctaacaaaaaaaatgcaattttaaccccctaattttgtcatgtttaggaaa 22699025  T
188 atatgctcttttggccccttgtctttacaaaaa-gttgcgattatggccccttttttgggacacgtggcgtcttctcaaca 267  Q
    |||||||||| || |||||| ||||| |||||| |||| |||| || ||||||||||||||||| ||||| ||||||||||    
22699024 atatgctcttctgaccccttatctttgcaaaaatgttgtgattttgaccccttttttgggacacatggcggcttctcaaca 22698944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 151 - 267
Target Start/End: Original strand, 35844808 - 35844925
Alignment:
151 gcaatttttaccccctaatttagccttgtttagggaaatatgctcttttggccccttgtctttac-aaaaagttgcgattatggccccttttttgggaca 249  Q
    |||||||| |||||||||||| | | |||||||  |||||||||||||||||||||| ||||||| ||||||||| |||| |||||||||||||||| ||    
35844808 gcaattttgaccccctaattttgtcatgtttagaaaaatatgctcttttggccccttatctttacaaaaaagttgtgattttggccccttttttggggca 35844907  T
250 cgtggcgtcttctcaaca 267  Q
    ||||||| ||||||||||    
35844908 cgtggcggcttctcaaca 35844925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 151 - 264
Target Start/End: Original strand, 11919737 - 11919851
Alignment:
151 gcaatttttaccccctaatttagccttgtttagggaaatatgctcttttggccccttgtctttac-aaaaagttgcgattatggccccttttttgggaca 249  Q
    |||||||| |||||||||||| ||| |||||||| ||||||||||||||| |||||| ||||||| |||||||||||||| ||  | |||||||||||||    
11919737 gcaattttgaccccctaattttgccatgtttaggaaaatatgctcttttgcccccttatctttacaaaaaagttgcgattttgatcacttttttgggaca 11919836  T
250 cgtggcgtcttctca 264  Q
    ||||||| |||||||    
11919837 cgtggcggcttctca 11919851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 186 - 297
Target Start/End: Complemental strand, 6763894 - 6763784
Alignment:
186 aaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaagggga 285  Q
    ||||||||| ||||| |||||| |||||||||||||| ||||||| ||||||||||||||||||||||||||||||||| || |||| |||| ||  |||    
6763894 aaatatgct-ttttgaccccttatctttacaaaaagtagcgattacggccccttttttgggacacgtggcgtcttctcagcaattttgggataaaatgga 6763796  T
286 ctaaaattgcca 297  Q
    | ||||||||||    
6763795 ccaaaattgcca 6763784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 182 - 297
Target Start/End: Complemental strand, 9051208 - 9051095
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||||| ||||| || ||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||| || ||||  |||||||    
9051208 agggaaatatgct-ttttgacctcttatctttacaaaaagttgcgattatggccc-ttttttgggacacggggcgtcttctcagcaattttgagatgaag 9051111  T
282 gggactaaaattgcca 297  Q
    ||| | ||||||||||    
9051110 ggggccaaaattgcca 9051095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 177 - 255
Target Start/End: Original strand, 15147830 - 15147908
Alignment:
177 tgtttagggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggc 255  Q
    ||||||||||||||||||||||||  || || |||| |||||||||||||||||| |||||||||||||||||||||||    
15147830 tgtttagggaaatatgctcttttgatccattatcttaacaaaaagttgcgattatagccccttttttgggacacgtggc 15147908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 182 - 296
Target Start/End: Original strand, 22191169 - 22191281
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    |||||||||||| |||||| |||||| ||||||||||||||| |||||||| ||| ||||||||||||||||||| ||||||| || |||| |||||||     
22191169 agggaaatatgc-cttttgaccccttatctttacaaaaagttacgattatgaccc-ttttttgggacacgtggcgccttctcagcaattttgggatgaaa 22191266  T
282 gggactaaaattgcc 296  Q
    ||| | |||||||||    
22191267 ggggccaaaattgcc 22191281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 182 - 295
Target Start/End: Original strand, 15700870 - 15700982
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||| | ||||| |||||| |||||||||||||||||||||||| |||||||| ||||||||||||| |||||| | || |||| |||||||     
15700870 agggaaatatgtt-ttttgaccccttatctttacaaaaagttgcgattatgaccccttttctgggacacgtggcatcttctgagcaattttgggatgaaa 15700968  T
282 gggactaaaattgc 295  Q
    ||| | ||||||||    
15700969 ggggccaaaattgc 15700982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 182 - 264
Target Start/End: Complemental strand, 4105006 - 4104924
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctca 264  Q
    |||| |||||||||||||| | |||| | |||||||||||||||||||||| ||||||||| || ||||||||||||||||||    
4105006 aggggaatatgctcttttgacaccttatatttacaaaaagttgcgattatgacccctttttaggaacacgtggcgtcttctca 4104924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 151 - 267
Target Start/End: Complemental strand, 9775575 - 9775458
Alignment:
151 gcaatttttaccccctaatttagccttgtttagggaaatatgctcttttggccccttgtctttacaaaaa-gttgcgattatggccccttttttgggaca 249  Q
    |||||||| |||||||||||| | | |||||||| |||||||||||| || |||||| ||||| |||||| |||| |||| || ||||||||||||||||    
9775575 gcaattttaaccccctaattttgtcatgtttaggaaaatatgctcttctgaccccttatctttgcaaaaatgttgtgattttgaccccttttttgggaca 9775476  T
250 cgtggcgtcttctcaaca 267  Q
    |  |||| ||||||||||    
9775475 cacggcggcttctcaaca 9775458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 185 - 264
Target Start/End: Original strand, 14743443 - 14743522
Alignment:
185 gaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctca 264  Q
    ||||||||||||||||||||||| | ||| |||||| |||||||||| |||||| ||||||||||||||| | |||||||    
14743443 gaaatatgctcttttggccccttatttttgcaaaaatttgcgattatagcccctattttgggacacgtggtggcttctca 14743522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 151 - 267
Target Start/End: Complemental strand, 28319219 - 28319103
Alignment:
151 gcaatttttaccccctaatttagccttgtttagggaaatatgctcttttggccccttgtctttacaaaa-agttgcgattatggccccttttttgggaca 249  Q
    |||||||| |||| |||| || ||| |||||||||||||||||| ||||||  |||| ||||||||||| ||||||||||||| ||| |||||||  |||    
28319219 gcaattttgaccctctaagtttgccatgtttagggaaatatgcttttttgg-tccttatctttacaaaatagttgcgattatgacccattttttgataca 28319121  T
250 cgtggcgtcttctcaaca 267  Q
    |||| || ||||||||||    
28319120 cgtgacggcttctcaaca 28319103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 186 - 264
Target Start/End: Original strand, 2190659 - 2190737
Alignment:
186 aaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctca 264  Q
    |||||||||| ||||||||||| |||||||||||||||||| ||||| ||| | |||||||||| || ||| |||||||    
2190659 aaatatgctcgtttggccccttatctttacaaaaagttgcggttatgacccatattttgggacatgttgcggcttctca 2190737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 182 - 264
Target Start/End: Original strand, 28365632 - 28365714
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctca 264  Q
    ||||||||||| ||||||  |||||| ||||  |||||||||||||||||| ||| ||||||||||| | |||||||||||||    
28365632 agggaaatatgatcttttaaccccttatcttctcaaaaagttgcgattatgaccctttttttgggacgcatggcgtcttctca 28365714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 182 - 272
Target Start/End: Complemental strand, 26829271 - 26829181
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggcccc-ttttttgggacacgtggcgtcttctcaacagtttt 272  Q
    ||||||||||| ||||||| |||||| || |  |||||||||| |||||||||||| |||||||||| |||| |||||||||||||| ||||    
26829271 agggaaatatgatcttttgaccccttatcatctcaaaaagttgtgattatggcccccttttttggga-acgtagcgtcttctcaacaatttt 26829181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 179 - 264
Target Start/End: Original strand, 2123494 - 2123580
Alignment:
179 tttagggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggc-cccttttttgggacacgtggcgtcttctca 264  Q
    |||||||||||| | ||||||| ||| || ||||||||||||||||| ||| || | |||| |||||||||| ||||||||||||||    
2123494 tttagggaaataagttcttttgaccctttatctttacaaaaagttgcaattttgacaccctgttttgggacatgtggcgtcttctca 2123580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 179 - 267
Target Start/End: Original strand, 74943 - 75031
Alignment:
179 tttagggaaatatgctcttttggccccttgtctttacaaaa-agttgcgattatggccccttttttgggacacgtggcgtcttctcaaca 267  Q
    |||||| ||||||||||||||| ||  || ||||||||||| ||||||||||||| |||| |||||| ||||||||||  ||||||||||    
74943 tttaggaaaatatgctcttttgcccttttatctttacaaaaaagttgcgattatgacccc-tttttgagacacgtggcagcttctcaaca 75031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 196 - 264
Target Start/End: Complemental strand, 22387236 - 22387167
Alignment:
196 ttttggccccttgtctttacaaaaagttgcgattatggcccc-ttttttgggacacgtggcgtcttctca 264  Q
    ||||| |||||| ||| |||||| ||||| |||||||||||| |||||||||||| ||||||||||||||    
22387236 ttttgaccccttatctatacaaagagttgtgattatggcccccttttttgggacaagtggcgtcttctca 22387167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 182 - 294
Target Start/End: Original strand, 36464395 - 36464506
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||  ||||||| | |||| ||||  |||||||||||||| ||||||||||||||| |||||||| | |||||||| || |||| ||| |||     
36464395 agggaaatataatcttttgactccttatcttctcaaaaagttgcgat-atggccccttttttgagacacgtgacatcttctcagcaattttgggacgaaa 36464493  T
282 gggactaaaattg 294  Q
     |||| |||||||    
36464494 tggaccaaaattg 36464506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 179 - 264
Target Start/End: Original strand, 33199572 - 33199658
Alignment:
179 tttagggaaatatgctcttttggccccttgtctttacaaaaa-gttgcgattatggccccttttttgggacacgtggcgtcttctca 264  Q
    |||||||||||||||||||||||||  || ||||||||||||  |||||||| || ||| | |||| ||||| ||| ||||||||||    
33199572 tttagggaaatatgctcttttggccttttatctttacaaaaatattgcgattttgacccttgttttaggacatgtgacgtcttctca 33199658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 151 - 267
Target Start/End: Original strand, 35935436 - 35935554
Alignment:
151 gcaatttttaccccctaatttagccttgtttagggaaatatgctcttttggccccttgtctttacaaaaa-gttgcgattatg-gccccttttttgggac 248  Q
    |||||||  |||||||||||| | | ||||| || |||||||||||| || |||||| ||||| |||||| |||| || | ||  |||||||||||||||    
35935436 gcaatttaaaccccctaattttgtcatgtttcggaaaatatgctcttctgaccccttatctttgcaaaaatgttgtgactttgacccccttttttgggac 35935535  T
249 acgtggcgtcttctcaaca 267  Q
    || ||||| ||||||||||    
35935536 acatggcgacttctcaaca 35935554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 182 - 263
Target Start/End: Original strand, 331835 - 331916
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctc 263  Q
    ||||||||||||| |||||  || || ||||| |||||||||||||||||| ||||| |||| | ||| |||||| ||||||    
331835 agggaaatatgcttttttgatccattatctttgcaaaaagttgcgattatgacccctatttttgaacatgtggcggcttctc 331916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 199 - 272
Target Start/End: Complemental strand, 21773496 - 21773423
Alignment:
199 tggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagtttt 272  Q
    ||||||||| ||||   |||||||||||||| | |||||| || ||||||||||||| ||||||||||| ||||    
21773496 tggccccttatcttctaaaaaagttgcgattttagcccctgttctgggacacgtggcttcttctcaacaatttt 21773423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 89 - 137
Target Start/End: Original strand, 25547803 - 25547851
Alignment:
89 aaatgcacttttgaccctttatgtttgtcgtcgtagccattttgacccc 137  Q
    |||||||||||||| ||| |||||||| ||||||||| |||||||||||    
25547803 aaatgcacttttgatcctctatgtttgccgtcgtagcaattttgacccc 25547851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 202 - 241
Target Start/End: Original strand, 4588003 - 4588042
Alignment:
202 ccccttgtctttacaaaaagttgcgattatggcccctttt 241  Q
    |||||| |||||||||||||||||||||||| ||||||||    
4588003 ccccttatctttacaaaaagttgcgattatgacccctttt 4588042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 182 - 248
Target Start/End: Complemental strand, 25884359 - 25884293
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggac 248  Q
    ||||||||||| | ||||  |||||| ||||  ||||||||||||||||| |||||| |||||||||    
25884359 agggaaatatgatattttaaccccttatcttctcaaaaagttgcgattattgcccctgttttgggac 25884293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0419 (Bit Score: 73; Significance: 3e-33; HSPs: 1)
Name: scaffold0419
Description:

Target: scaffold0419; HSP #1
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 182 - 339
Target Start/End: Complemental strand, 3141 - 2985
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||| | ||||| || ||| ||||||||||||||||| ||||||||| |||||||||||||||||||||||||||| || |||| ||||||||    
3141 agggaaatatgtt-ttttgacctcttatctttacaaaaagttgcaattatggcctcttttttgggacacgtggcgtcttctcatcaattttgggatgaag 3043  T
282 gggactaaaattgccannnnnnnaatagggagccaaaatcacaatattttgaaacata 339  Q
    ||| | ||||||||||       ||||||| ||||||||| ||| |||||||||||||    
3042 ggggccaaaattgccatttttttaatagggggccaaaatcgcaacattttgaaacata 2985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0025 (Bit Score: 72; Significance: 1e-32; HSPs: 2)
Name: scaffold0025
Description:

Target: scaffold0025; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 182 - 297
Target Start/End: Original strand, 19405 - 19519
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||||| ||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| |||||||     
19405 agggaaatatgct-ttttgaccccttatctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcagcaatttttggatgaaa 19503  T
282 gggactaaaattgcca 297  Q
     || | ||||||||||    
19504 tgggccaaaattgcca 19519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0025; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 182 - 295
Target Start/End: Original strand, 61937 - 62051
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggcccctttt--ttgggacacgtggcgtcttctcaacagttttaggatga 279  Q
    ||||||||||||| ||||| |||||| ||||||||||||||||| |||||||||||||||  |||||||||||||||||||||||||| |||| ||||||    
61937 agggaaatatgct-ttttgaccccttatctttacaaaaagttgcaattatggccccttttttttgggacacgtggcgtcttctcaacaatttttggatga 62035  T
280 aggggactaaaattgc 295  Q
    | ||| | ||||||||    
62036 aaggggccaaaattgc 62051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005 (Bit Score: 69; Significance: 7e-31; HSPs: 4)
Name: scaffold0005
Description:

Target: scaffold0005; HSP #1
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 151 - 262
Target Start/End: Original strand, 205026 - 205138
Alignment:
151 gcaatttttaccccctaatttagccttgtttagggaaatatgctcttttggccccttgtcttta-caaaaagttgcgattatggccccttttttgggaca 249  Q
    |||||||| |||||||||||| ||| ||||||||||||||||||||||||||||||| |||||| ||||||||| ||||| ||||||| ||||| |||||    
205026 gcaattttgaccccctaattttgccatgtttagggaaatatgctcttttggccccttatctttaccaaaaagttacgattttggccccctttttaggaca 205125  T
250 cgtggcgtcttct 262  Q
    ||||||| |||||    
205126 cgtggcggcttct 205138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 152 - 255
Target Start/End: Original strand, 54959 - 55062
Alignment:
152 caatttttaccccctaatttagccttgtttagggaaatatgctcttttggccccttgtctttac-aaaaagttgcgattatggccccttttttgggacac 250  Q
    ||||||| |||||||||||| ||  |||||||||||||||| | ||||| |||||| ||||||| ||||| |||| ||| ||| ||||||||||||||||    
54959 caattttaaccccctaattttgctatgtttagggaaatatgtttttttgaccccttatctttacaaaaaatttgcaattttgg-cccttttttgggacac 55057  T
251 gtggc 255  Q
    |||||    
55058 gtggc 55062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 177 - 272
Target Start/End: Complemental strand, 35291 - 35196
Alignment:
177 tgtttagggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagtttt 272  Q
    ||||||||||||||| |||||||| |||||| |||||| ||||| ||| |||||||    |||||||| ||||| |||||| ||||||||| ||||    
35291 tgtttagggaaatatactcttttgaccccttatctttagaaaaacttgtgattatgatatcttttttgagacacatggcgttttctcaacaatttt 35196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 89 - 137
Target Start/End: Complemental strand, 205236 - 205188
Alignment:
89 aaatgcacttttgaccctttatgtttgtcgtcgtagccattttgacccc 137  Q
    |||||||||||||  ||| |||||||||||||||||| |||||||||||    
205236 aaatgcacttttggtcctctatgtttgtcgtcgtagcaattttgacccc 205188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0607 (Bit Score: 66; Significance: 4e-29; HSPs: 1)
Name: scaffold0607
Description:

Target: scaffold0607; HSP #1
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 182 - 295
Target Start/End: Complemental strand, 2230 - 2118
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    |||| |||||||| ||||| |||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||| || |||| |||||||     
2230 agggcaatatgct-ttttgaccccttatctttacaaaaagttgcgattatgaccccttttttgggacacgtggcgtcttctcagcaatttttggatgaaa 2132  T
282 gggactaaaattgc 295  Q
    ||| | ||||||||    
2131 ggggccaaaattgc 2118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1875 (Bit Score: 64; Significance: 7e-28; HSPs: 1)
Name: scaffold1875
Description:

Target: scaffold1875; HSP #1
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 186 - 297
Target Start/End: Complemental strand, 934 - 823
Alignment:
186 aaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaagggga 285  Q
    ||||||||||||||| |||||| ||||||||||||||||| |||||| |||||| |||||||||  |||||||||||||||| |||| ||| |||||||     
934 aaatatgctcttttgaccccttatctttacaaaaagttgcaattatgaccccttatttgggacatctggcgtcttctcaacaattttgggacgaaggggg 835  T
286 ctaaaattgcca 297  Q
    | ||||||||||    
834 ccaaaattgcca 823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0007 (Bit Score: 64; Significance: 7e-28; HSPs: 1)
Name: scaffold0007
Description:

Target: scaffold0007; HSP #1
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 182 - 297
Target Start/End: Complemental strand, 250699 - 250585
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||| | ||||| |||||| |||||||||||||||| ||||||||||||||||||||| ||||||||||||||||| || ||||  |||||||    
250699 agggaaatatgtt-ttttgaccccttatctttacaaaaagttgtgattatggccccttttttggggcacgtggcgtcttctcagcaattttcagatgaag 250601  T
282 gggactaaaattgcca 297  Q
    ||| | ||||||||||    
250600 ggggccaaaattgcca 250585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0406 (Bit Score: 62; Significance: 1e-26; HSPs: 1)
Name: scaffold0406
Description:

Target: scaffold0406; HSP #1
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 182 - 295
Target Start/End: Original strand, 2114 - 2226
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||| ||||| ||||| |||| | ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| || |||| |||||||     
2114 agggaaacatgct-ttttgaccccatatctttacaaaaagttgcgattatagccccttttttgggacacgtggcgtcttctcagcaatttttggatgaaa 2212  T
282 gggactaaaattgc 295  Q
    ||| | ||||||||    
2213 ggggccaaaattgc 2226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0179 (Bit Score: 60; Significance: 2e-25; HSPs: 1)
Name: scaffold0179
Description:

Target: scaffold0179; HSP #1
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 182 - 297
Target Start/End: Complemental strand, 5830 - 5717
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||| | ||||| |||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||| || || |||| |||| ||     
5830 agggaaatatgtt-ttttgaccccttatctttacaaaaagttgcgattatggccc-ttttttgggacacgtggcgtcttcgcagcaattttgggataaaa 5733  T
282 gggactaaaattgcca 297  Q
    ||||| ||||||||||    
5732 gggaccaaaattgcca 5717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0087 (Bit Score: 60; Significance: 2e-25; HSPs: 1)
Name: scaffold0087
Description:

Target: scaffold0087; HSP #1
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 182 - 297
Target Start/End: Complemental strand, 25145 - 25031
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||||| ||||| |||||| ||||||  |||||||| ||||||||||||||||||||||||||||||||||||||| || |||| | |||||     
25145 agggaaatatgct-ttttgaccccttatctttaacaaaagttgtgattatggccccttttttgggacacgtggcgtcttctcagcaattttggtatgaaa 25047  T
282 gggactaaaattgcca 297  Q
    ||| | ||||||||||    
25046 ggggccaaaattgcca 25031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0001 (Bit Score: 58; Significance: 3e-24; HSPs: 1)
Name: scaffold0001
Description:

Target: scaffold0001; HSP #1
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 182 - 295
Target Start/End: Complemental strand, 142128 - 142016
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||||| ||||| || ||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||| | || ||||  ||||||     
142128 agggaaatatgct-ttttgacctcttatctttacaaaaagttgcgattatggcccattttttgggacacgtggcgtcttctaagcaatttttagatgaaa 142030  T
282 gggactaaaattgc 295  Q
    ||| | ||||||||    
142029 ggggccaaaattgc 142016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0150 (Bit Score: 57; Significance: 1e-23; HSPs: 1)
Name: scaffold0150
Description:

Target: scaffold0150; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 182 - 339
Target Start/End: Original strand, 5955 - 6110
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||||| ||||| |||||| |||||| ||||||||||||||||| ||  |||||||||||||||||| |||||||| || |||| ||||||||    
5955 agggaaatatgct-ttttgaccccttatctttataaaaagttgcgattatgacct-ttttttgggacacgtggcatcttctcagcaattttgggatgaag 6052  T
282 gggactaaaattgccannnnnnnaatagggagccaaaatcacaatattttgaaacata 339  Q
    ||| | ||||||||||       ||||||| ||||||||| ||| ||||  |||||||    
6053 ggggccaaaattgccatttttttaatagggggccaaaatcgcaacatttaaaaacata 6110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0267 (Bit Score: 55; Significance: 2e-22; HSPs: 1)
Name: scaffold0267
Description:

Target: scaffold0267; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 182 - 280
Target Start/End: Complemental strand, 3749 - 3652
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaa 280  Q
    ||||||||||||| ||||| |||||| ||||||||||||||| ||||||| ||||||||||||||||||| || ||||||||| || |||| |||||||    
3749 agggaaatatgct-ttttgaccccttatctttacaaaaagtttcgattatagccccttttttgggacacgaggtgtcttctcagcaattttgggatgaa 3652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0062 (Bit Score: 54; Significance: 6e-22; HSPs: 2)
Name: scaffold0062
Description:

Target: scaffold0062; HSP #1
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 182 - 295
Target Start/End: Original strand, 49782 - 49894
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||| | ||||| |||||| |||||||||||||||||||||||| |||||||| ||||||||||||| |||||| | || |||| |||||||     
49782 agggaaatatgtt-ttttgaccccttatctttacaaaaagttgcgattatgaccccttttctgggacacgtggcatcttctgagcaattttgggatgaaa 49880  T
282 gggactaaaattgc 295  Q
    ||| | ||||||||    
49881 ggggccaaaattgc 49894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0062; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 182 - 295
Target Start/End: Original strand, 62321 - 62433
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||| | ||||| |||||| |||||||||||||||||||||||| |||||||| ||||||||||||| |||||| | || |||| |||||||     
62321 agggaaatatgtt-ttttgaccccttatctttacaaaaagttgcgattatgaccccttttctgggacacgtggcatcttctgagcaattttgggatgaaa 62419  T
282 gggactaaaattgc 295  Q
    ||| | ||||||||    
62420 ggggccaaaattgc 62433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0060 (Bit Score: 54; Significance: 6e-22; HSPs: 1)
Name: scaffold0060
Description:

Target: scaffold0060; HSP #1
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 182 - 295
Target Start/End: Original strand, 66297 - 66409
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    |||||| |||||| ||||| |||||| |||||||||||||||||||||||| |||||||||| | ||||||||||||||||||  | |||| |||||||     
66297 agggaactatgct-ttttgaccccttatctttacaaaaagttgcgattatgacccctttttttgaacacgtggcgtcttctcagaaatttttggatgaaa 66395  T
282 gggactaaaattgc 295  Q
    ||| | ||||||||    
66396 ggggccaaaattgc 66409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0173 (Bit Score: 52; Significance: 1e-20; HSPs: 1)
Name: scaffold0173
Description:

Target: scaffold0173; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 89 - 255
Target Start/End: Original strand, 22814 - 22983
Alignment:
89 aaatgcacttttgaccctttatgtttgtcgtcgtagccattttgacccctaacnnnnnnnnn-gcaatttttaccccctaatttagccttgtttagggaa 187  Q
    ||||||||||||| ||| ||||||||| | ||||||| |||||||||||||||          |||||||| |||||||| ||| ||| |||||||| ||    
22814 aaatgcacttttggccccttatgtttgccatcgtagcaattttgacccctaacaaaacaaaatgcaattttgaccccctatttttgccatgtttaggtaa 22913  T
188 atatgctcttttggccccttgtctttacaaaaa--gttgcgattatggccccttttttgggacacgtggc 255  Q
    ||||| | |||| ||||||| ||||| ||||||  ||||| |||||||||| |||||||||||| |||||    
22914 atatgttttttttgccccttatctttgcaaaaaaagttgcaattatggcccattttttgggacatgtggc 22983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002 (Bit Score: 51; Significance: 4e-20; HSPs: 1)
Name: scaffold0002
Description:

Target: scaffold0002; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 182 - 280
Target Start/End: Original strand, 455149 - 455247
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaa 280  Q
    ||||||||||| ||||||| |||||| ||||  | |||||||||||||||| ||| |||||||||||| |||||||||||||| || |||| |||||||    
455149 agggaaatatgatcttttgaccccttatcttctctaaaagttgcgattatgacccattttttgggacatgtggcgtcttctcagcaattttgggatgaa 455247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0291 (Bit Score: 49; Significance: 6e-19; HSPs: 1)
Name: scaffold0291
Description:

Target: scaffold0291; HSP #1
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 186 - 294
Target Start/End: Original strand, 10047 - 10155
Alignment:
186 aaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaagggga 285  Q
    ||||||| ||||| | |||||| ||||  |||||||||||||||||  ||||||||||| |||| ||||||||||||||||| |||| ||| ||| ||||    
10047 aaatatgatctttagaccccttatcttctcaaaaagttgcgattatttccccttttttgtgacatgtggcgtcttctcaacaattttgggacgaaaggga 10146  T
286 ctaaaattg 294  Q
    | |||||||    
10147 ccaaaattg 10155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0084 (Bit Score: 46; Significance: 4e-17; HSPs: 1)
Name: scaffold0084
Description:

Target: scaffold0084; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 179 - 267
Target Start/End: Complemental strand, 4701 - 4613
Alignment:
179 tttagggaaatatgctcttttggccccttgtctttaca-aaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaaca 267  Q
    |||||| ||||||||||||||| |||||| |||||||| ||||||||||||| ||||||| ||||||||||| |||||  ||||||||||    
4701 tttaggaaaatatgctcttttgaccccttatctttacaaaaaagttgcgattttggcccc-tttttgggacaggtggcagcttctcaaca 4613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0024 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: scaffold0024
Description:

Target: scaffold0024; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 182 - 264
Target Start/End: Complemental strand, 44006 - 43924
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctca 264  Q
    ||||||||||| ||||||| ||  || ||||  ||||||||||||| ||||| |||| |||||||||||||||||||||||||    
44006 agggaaatatgatcttttgaccttttatcttctcaaaaagttgcgactatggtccctgttttgggacacgtggcgtcttctca 43924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0014 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: scaffold0014
Description:

Target: scaffold0014; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 182 - 276
Target Start/End: Original strand, 112249 - 112343
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttagga 276  Q
    ||||||||||| ||||||| | |||| ||||  |||||||||||| |||||| || |||||||||||| |||||||||||||  || ||||||||    
112249 agggaaatatgatcttttgactccttatcttctcaaaaagttgcggttatggtccattttttgggacatgtggcgtcttctctgcaattttagga 112343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0683 (Bit Score: 42; Significance: 0.000000000000009; HSPs: 1)
Name: scaffold0683
Description:

Target: scaffold0683; HSP #1
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 224 - 297
Target Start/End: Complemental strand, 5261 - 5188
Alignment:
224 gcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaaggggactaaaattgcca 297  Q
    ||||||||||||||||||||||||||| || |||||||||| || |||| ||||||| ||| | ||||||||||    
5261 gcgattatggccccttttttgggacacatgacgtcttctcagcaatttttggatgaaaggggccaaaattgcca 5188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0010 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: scaffold0010
Description:

Target: scaffold0010; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 151 - 267
Target Start/End: Complemental strand, 128563 - 128448
Alignment:
151 gcaatttttaccccctaatttagccttgtttagggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacac 250  Q
    |||||||| ||| |||||||| | | |||||||| |||||   ||||||| |||||| |||  | |||||||||||||| || |||||||||||| ||||    
128563 gcaattttgaccacctaattttgacatgtttaggaaaatacagtcttttgaccccttatctaca-aaaaagttgcgattttgaccccttttttggaacac 128465  T
251 gtggcgtcttctcaaca 267  Q
    |||||| ||||||||||    
128464 gtggcggcttctcaaca 128448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0474 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 1)
Name: scaffold0474
Description:

Target: scaffold0474; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 215 - 277
Target Start/End: Complemental strand, 8129 - 8067
Alignment:
215 caaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggat 277  Q
    |||||| ||||||||||||||||| |||||||||||||||| |||||||| || |||| ||||    
8129 caaaaatttgcgattatggcccctgttttgggacacgtggcatcttctcagcaattttgggat 8067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0174 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0174
Description:

Target: scaffold0174; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 182 - 295
Target Start/End: Original strand, 29838 - 29951
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatggccccttttttgggacacgtggcgtcttctcaacagttttaggatgaag 281  Q
    ||||||||||| ||||||| |||||| ||||  ||||||||||| ||||||||| ||  ||||| ||  |||||||||||||| || |||| ||| |||     
29838 agggaaatatgatcttttgaccccttatcttctcaaaaagttgcaattatggcctctgatttggaacctgtggcgtcttctcagcaattttgggacgaaa 29937  T
282 gggactaaaattgc 295  Q
    ||| | ||||||||    
29938 ggggccaaaattgc 29951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0171 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0171
Description:

Target: scaffold0171; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 194 - 262
Target Start/End: Original strand, 9166 - 9235
Alignment:
194 tcttttggccccttgtctttacaaaaagttgcgattatg-gccccttttttgggacacgtggcgtcttct 262  Q
    ||||||| ||| || ||||| ||||||||||||||||||  |||||||||||||||||||| ||||||||    
9166 tcttttgacccattatcttttcaaaaagttgcgattatgacccccttttttgggacacgtgacgtcttct 9235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0103 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0103
Description:

Target: scaffold0103; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 186 - 294
Target Start/End: Complemental strand, 3106 - 2997
Alignment:
186 aaatatgctcttttggccccttgtctttacaaaaagttgcgattatg-gccccttttttgggacacgtggcgtcttctcaacagttttaggatgaagggg 284  Q
    ||||||||| ||||| |||||| | ||||||||||||||||||||||  ||||||| | || ||| |||||||||||||  || |||||||| ||| |||    
3106 aaatatgctattttgaccccttatttttacaaaaagttgcgattatgaccccctttctaggaacatgtggcgtcttctcttcaattttaggacgaaaggg 3007  T
285 actaaaattg 294  Q
     | |||||||    
3006 gccaaaattg 2997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1202 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold1202
Description:

Target: scaffold1202; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 182 - 232
Target Start/End: Complemental strand, 1955 - 1906
Alignment:
182 agggaaatatgctcttttggccccttgtctttacaaaaagttgcgattatg 232  Q
    ||||||||||||| ||||| |||||| ||||||||||||||||||||||||    
1955 agggaaatatgct-ttttgaccccttatctttacaaaaagttgcgattatg 1906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University