View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1546_low_8 (Length: 286)
Name: NF1546_low_8
Description: NF1546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1546_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 119; Significance: 8e-61; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 119; E-Value: 8e-61
Query Start/End: Original strand, 96 - 269
Target Start/End: Original strand, 34153962 - 34154135
Alignment:
| Q |
96 |
atatatatattatcgattactaatcacatgcaggtactacgactacacctagtaaagtgcattcataattagcttatgtaaatataaataatattggt-n |
194 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
34153962 |
atatatatattatcgattactaatgacatgcaggtactacgactacacctagtaaagtgcattcataattagcttatgtaaatat-aataatattggtaa |
34154060 |
T |
 |
| Q |
195 |
nnnnnnncttatacgtacattatcatcatgcgttcaagataataagcttaaagcacttttattaggggaatgatt |
269 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
34154061 |
aaaaaaacttatacgtaaattatcatcatgcgttcaagataataagcttatagcacttttatcaggggaatgatt |
34154135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 13 - 105
Target Start/End: Original strand, 34153847 - 34153939
Alignment:
| Q |
13 |
tgagttaggcatcacaaatggatggtgctcttaaagattgtatgcagcagataacaatatgctacatttccttttttacattaatatatatat |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34153847 |
tgagttaggcatcacaaatggatggtgctcttaaagattgtatgcagcagataacaatatgctacatttccttttttacattaatatatatat |
34153939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University