View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15471_high_11 (Length: 265)
Name: NF15471_high_11
Description: NF15471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15471_high_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 212; Significance: 1e-116; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 19 - 248
Target Start/End: Complemental strand, 1160242 - 1160016
Alignment:
| Q |
19 |
gaaggtcaggtggagcagctgcaggaattatcggcggtgcagtggctggtggagttgctggtggagtggttggtggtgcagtcgccaatcacgggcacaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1160242 |
gaaggtcaggtggagcagctgcaggaattatcggcggtgcagtggctggtggagttgctggtggagtggttggtggtgcagtcgccaatcacgggcacaa |
1160143 |
T |
 |
| Q |
119 |
ttatgaacacaaacaccttcatgtttgtgtcccaacatttattttatgtttgagttttttgctttaatcatgttgttttacttccacagctaattaagta |
218 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
1160142 |
ttatggacacaaacaccttcatgtttgtgtcccaacatttattttatgtttgagttttttgctttaatcatgttgttttacttcca---ctaattaagta |
1160046 |
T |
 |
| Q |
219 |
tcatgtttagttgcttctgtttaggcctat |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
1160045 |
tcatgtttagttgcttctgtttaggcctat |
1160016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 139 - 205
Target Start/End: Complemental strand, 1141737 - 1141671
Alignment:
| Q |
139 |
atgtttgtgtcccaacatttattttatgtttgagttttttgctttaatcatgttgttttacttccac |
205 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |||| | | ||||||| |||||| |||||||| |
|
|
| T |
1141737 |
atgtttgtgtctcaacatttattttatgtttgagcttttggttataatcatattgtttcacttccac |
1141671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 139 - 205
Target Start/End: Complemental strand, 1137083 - 1137017
Alignment:
| Q |
139 |
atgtttgtgtcccaacatttattttatgtttgagttttttgctttaatcatgttgttttacttccac |
205 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||| |||| |||||||| | |||||| |||||||| |
|
|
| T |
1137083 |
atgtttgtgtctcaacatttcttttatgtttgagcttttggctttaattacattgtttcacttccac |
1137017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University