View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15471_high_13 (Length: 242)
Name: NF15471_high_13
Description: NF15471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15471_high_13 |
 |  |
|
| [»] scaffold0182 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 26395828 - 26395602
Alignment:
| Q |
1 |
tttatgtttgattttagactaaaagatgttttcattggtttaactttatagttttgttgtgttaaaggattggatcctatattacatttgttatcctatt |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26395828 |
tttatgtttcattttagactaaaagatgttttcattggtttaactttatagttttgttgtgttaaaggattggatcctatattacatttgttatcctatt |
26395729 |
T |
 |
| Q |
101 |
atgatttatgactattttggctgtgcatatttatctcgttaaaataaaatggaaagcatatttatcatcctttgaactcttgttggattttttaattctg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26395728 |
atgatttatgactattttggctgtgcatatttatctcgttaaaataaaatggaaagcatatttatcatcctttgaactcttgttggattttttaattctg |
26395629 |
T |
 |
| Q |
201 |
ctgtagcagatgatggtcaatcaaaat |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
26395628 |
ctgtagcagatgatggtcaatcaaaat |
26395602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0182 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: scaffold0182
Description:
Target: scaffold0182; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 28114 - 27888
Alignment:
| Q |
1 |
tttatgtttgattttagactaaaagatgttttcattggtttaactttatagttttgttgtgttaaaggattggatcctatattacatttgttatcctatt |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28114 |
tttatgtttcattttagactaaaagatgttttcattggtttaactttatagttttgttgtgttaaaggattggatcctatattacatttgttatcctatt |
28015 |
T |
 |
| Q |
101 |
atgatttatgactattttggctgtgcatatttatctcgttaaaataaaatggaaagcatatttatcatcctttgaactcttgttggattttttaattctg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28014 |
atgatttatgactattttggctgtgcatatttatctcgttaaaataaaatggaaaacatatttatcatcctttgaactcttgttggattttttaattctg |
27915 |
T |
 |
| Q |
201 |
ctgtagcagatgatggtcaatcaaaat |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
27914 |
ctgtagcagatgatggtcaatcaaaat |
27888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University