View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15471_low_7 (Length: 376)
Name: NF15471_low_7
Description: NF15471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15471_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 321; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 1 - 358
Target Start/End: Original strand, 47585422 - 47585774
Alignment:
| Q |
1 |
gccgggaaagtttgatattgctggccatagtcaccaactttttcatgtcttggttgtggcggaggcatatacaccttaccgtgatgggttaatttacctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
47585422 |
gccgggaaagtttgatattgctggccatagtcaccaactttttcatgtcttggttgtggcgggggcatatacacattaccgtgatgggttaatttacctt |
47585521 |
T |
 |
| Q |
101 |
agatggagagatttgaaaggctgttaattaggccggtagggagtctgttgtaggtactttggctttctttttgttgttcaaaacttagagatattggatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
47585522 |
agatggagagatttgaaaggctgttaattaggccggtagggagtctgttgtaggtactttggctttctttttgttgttcaaaactt--agatattggatg |
47585619 |
T |
 |
| Q |
201 |
aaagatgaagaaagtgattgtgtattattgtatagaaaaaagctccatgcttcttttttgtgttagatttatgaatctaaaaacaaagaggtaaatctaa |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47585620 |
aaagatgaagaaagtgattgtgtattattgtatagaaaaaagcttcatgcttcttttttgtgttagatttatgaatctaaaaacaaagaggtaaatctaa |
47585719 |
T |
 |
| Q |
301 |
gagaatacatggattttttgttctatcaaaagtatgtagtatattacatgtaaatcct |
358 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
47585720 |
gagaatacatggattttttgttctatcaaaagtatgtagta---tacatgtaaatcct |
47585774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University