View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15471_low_8 (Length: 368)
Name: NF15471_low_8
Description: NF15471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15471_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 309; Significance: 1e-174; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 24 - 355
Target Start/End: Original strand, 36040514 - 36040843
Alignment:
| Q |
24 |
aaagtttttataattaaggacactgatttatcattttgctcaacgctcccgaaatctcaagaccagcactaccacgtgacaatggtaaaaggttaataat |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
36040514 |
aaagtttttataattaaggacactgatttatcattttgctgaacgctcccgaaatctcaagaccagcactaccacgtgacaatggtaaaaggttaaaaat |
36040613 |
T |
 |
| Q |
124 |
ttcgacattttttcaaaatatggatataagacatgtcctatagtaacttatcacatttccatccctacttcagtgaggtacttgttgctgggtgtagtgc |
223 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36040614 |
ttcgacattttttcaaaatatgggtataagacatgtcctatagtaacttatcacatttccatccctacttcagtgaggtacttgttgctgggtgtagt-- |
36040711 |
T |
 |
| Q |
224 |
gcccttattgctttctttaggttatctattggtaggttgggcagaaatacgagtatgcatttctctaatttggtcttcttgtctaatgaatcattttcaa |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36040712 |
gcccttattgctttctttaggttatctattggtaggttgggcagaaatacgagtatgcatttctctaatttggtcttcttgtctaatgaatcattttcaa |
36040811 |
T |
 |
| Q |
324 |
taaatatttgtaaacttttcataacctcattt |
355 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
36040812 |
taaatatttgtaaacttttcataacctcattt |
36040843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University