View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15475_high_8 (Length: 228)
Name: NF15475_high_8
Description: NF15475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15475_high_8 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 73 - 228
Target Start/End: Complemental strand, 12690295 - 12690140
Alignment:
| Q |
73 |
gtgagatgaatttggaggtttggaaacgttttaccaatcgtggctattgagatggcatacaggagctattctcataacagttaattgtgtatgattatat |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
12690295 |
gtgagatgaatttggaggtttggaaacgttttaccaatcgtggctattgagatggcatacaggagctattctcataacaattaattgtgtatgattatat |
12690196 |
T |
 |
| Q |
173 |
atttaattgaaacgatgcaaaataatagaggaacttttatcgtatatgccgatgtc |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
12690195 |
atttaattgaaacgatgcaaaataatagaggaacttttatcgtatacgctgatgtc |
12690140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University