View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15477_high_2 (Length: 279)
Name: NF15477_high_2
Description: NF15477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15477_high_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 6 - 130
Target Start/End: Original strand, 27462408 - 27462532
Alignment:
| Q |
6 |
gaatcgttaagtgtttgtcaacttatagcacacaatcttccaagaatagctcgacgaggtaactgccatgatcatggcttggcaccgaataaacagttac |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27462408 |
gaatcgttaagtgtttgtcaacttatagcacacaatcttccaagaatagctcgacgaggtaactgccatgatcatggcttggcaccgaataaacagttac |
27462507 |
T |
 |
| Q |
106 |
ttagtttcccatctacgtttccatg |
130 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
27462508 |
ttagtttcccatctacgtttccatg |
27462532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 194 - 263
Target Start/End: Original strand, 27462532 - 27462601
Alignment:
| Q |
194 |
ggcaaagtagtgggaggttaaatttgtcattcctatttgaaaattttcttaattttattcaatttctgag |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
27462532 |
ggcaaagtagtgggaggttaaatttgtcattcctatttgagaattttcttaattttattcaatttctgag |
27462601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University