View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15477_low_4 (Length: 233)
Name: NF15477_low_4
Description: NF15477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15477_low_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 2 - 218
Target Start/End: Original strand, 37257457 - 37257679
Alignment:
| Q |
2 |
tgattgattgctagtatgttatatagagatgccaaagccattaagatgagttataaatttgattatatat--gtgttaattgagatactgcttttataaa |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
37257457 |
tgattgattgctagtatgttatatagagatgccaaagccattaagatgagttataaatttgattatatatatgtgttaattgagatactgcttttataaa |
37257556 |
T |
|
| Q |
100 |
tatgta------cctttgtttaatattctataaattattgtttatatgattatcaatcaacaggagcagtttcggttttgagattatttactactaatga |
193 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
37257557 |
tatgtatatgcacctttgtttaatattctataaattattgtttatatgattatcaatcaacaagagcagtttcggttttgagattatttacta--aatga |
37257654 |
T |
|
| Q |
194 |
tcaccatattattcatgatgaagct |
218 |
Q |
| |
|
||||||||| ||||||||||||||| |
|
|
| T |
37257655 |
tcaccatatgattcatgatgaagct |
37257679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University