View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1547_high_18 (Length: 342)
Name: NF1547_high_18
Description: NF1547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1547_high_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 10 - 244
Target Start/End: Original strand, 9733636 - 9733870
Alignment:
| Q |
10 |
aatgaaaatcaaagatcacttttttgtttaactcatttgatttcacttgttgaagctgcaaaaccaaaaccaactttttgaagagttgtttttcacttcc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9733636 |
aatgaaaatcaaagatcacttttttgtttaactcatttgatttcacttgttgaagctgcaaaaccaaaaccaactttttgaagagttgtttttctcttcc |
9733735 |
T |
 |
| Q |
110 |
ttcctttaggtgatgtcgttgtctttgattgtttctcccaaaagaacctgaacgaatccacgttaccaacttgccaacgttgttgcttttttctgctctt |
209 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9733736 |
ttcctttaggtgatgtctttgtctttgattgtttctcccaaaagaacctgaacgaatccacgttaccaacttgccaacgttgttgcttttttctgctctt |
9733835 |
T |
 |
| Q |
210 |
gtttcataataatgttgcagttcttcacagtgctg |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
9733836 |
gtttcataataatgttgcagttcttcacagtgctg |
9733870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University