View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1547_high_21 (Length: 316)
Name: NF1547_high_21
Description: NF1547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1547_high_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 31 - 299
Target Start/End: Complemental strand, 27067806 - 27067538
Alignment:
| Q |
31 |
ctaatgctaaaattatccgtgacaagatctatcaaaaatctcagttattgcttacatggcaacataattttattttgnnnnnnncagtacaaactacttt |
130 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
27067806 |
ctaatgctaaaattatcggtgacaagatctatcaaaaatctcagttattgcttacatgacaacataattttattttgaaaaaaacagtacaaactacttt |
27067707 |
T |
|
| Q |
131 |
aattctataaattattggttacagcaacactgaaactcactacactttccaccttatcccttccttcactctttctcaatgttatctctatagaaaccat |
230 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27067706 |
aattctataaattattgcttacagcaacactgaaactcactacactttccaccttatcccttccttcactctttctcaatgttatctctatagaaaccat |
27067607 |
T |
|
| Q |
231 |
tgaagaagtataaacataaatattcacataattcatgaagaaaatgcagaaacaacttggtcacattat |
299 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27067606 |
tgaagaaatataaacataaatattcacataattcatgaagaaaatgcagaaacaacttggtcacattat |
27067538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University