View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1547_high_34 (Length: 250)
Name: NF1547_high_34
Description: NF1547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1547_high_34 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 10 - 235
Target Start/End: Original strand, 14856597 - 14856824
Alignment:
| Q |
10 |
aaaatcatcagtggctaaacgcgttaaattcaataatatgtaaaataaaaacaagatatgtcaccaatcatcaagtctcacggtacgtattgtcaacatt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14856597 |
aaaatcatcagtggctaaacgcgttaaattcaataatatgtaaaataaaaacaagatatgtcaccaatcatcaagtctcacggtacgtattgtcaacatt |
14856696 |
T |
 |
| Q |
110 |
ggtcattaagtatggggatttcctggctttcagctccacaatttctatcattctgtctctttctcctaacc--nnnnnnnngagaaactagggcataaaa |
207 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
14856697 |
ggtcattaagtatggggatttcttggctttcagctccacaatttctatcattctgtctctttctcctaacctttttttttatagaaaatagggcataaaa |
14856796 |
T |
 |
| Q |
208 |
atttagaaacatgttcttggagctattt |
235 |
Q |
| |
|
|||||||||||| ||||||||||||||| |
|
|
| T |
14856797 |
atttagaaacattttcttggagctattt |
14856824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University