View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1547_high_49 (Length: 237)
Name: NF1547_high_49
Description: NF1547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1547_high_49 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 43486192 - 43486413
Alignment:
| Q |
1 |
cctctccttccaaccccttgtaccattcgaaattgactctttatatctaagtcatgagataagttattacacaaactgatttgataaaatacatagatca |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43486192 |
cctctccttccaaccccttgtaccatttgaaattgactctttatatctaagtcatgagataagttattacacaaactgatttgataaaatacatagatca |
43486291 |
T |
 |
| Q |
101 |
agcacnnnnnnnnnnnnnnnnnnataagaaacatacctcattgacactgcattgagtttggaccgcaaagtatctgaaaatgaatggaattctgatgacc |
200 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43486292 |
agcacatatatagtatata----ataagaaacatacctcattgacactgcattgagtttggaccgcaaagtatctgaaaatgaatggaattctgatgacc |
43486387 |
T |
 |
| Q |
201 |
tttctctattttggtttattggagaa |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
43486388 |
tttctctattttggtttattggagaa |
43486413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University