View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1547_high_50 (Length: 232)
Name: NF1547_high_50
Description: NF1547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1547_high_50 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 10 - 217
Target Start/End: Complemental strand, 51656038 - 51655832
Alignment:
| Q |
10 |
tgagatgaagttgtgtactataaaactatatacctaaataacactcgccgcccaacaaaatcatgcttagtgtgattatttcctcccatagtattttgaa |
109 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
51656038 |
tgagacgaagtcgtgtactataaaactatatacctaaatagcactcgccgcccaacaaaatcatgcttagtgtgattctttccccccatagtattttgaa |
51655939 |
T |
 |
| Q |
110 |
tagaatcataaagtttgaatgggtaaaatgagatcagataaaaggttacatcatttacannnnnnnnagtttcgtagcggccttttatcttctttaaaat |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
51655938 |
tagaatcataaagtttgaatgggtaaaatgagatcagataaaaggttacatcatttaca-tttttttagtttcgtagcggccttttatcttctttaaaat |
51655840 |
T |
 |
| Q |
210 |
gttacatc |
217 |
Q |
| |
|
|||||||| |
|
|
| T |
51655839 |
gttacatc |
51655832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University