View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1547_high_7 (Length: 461)
Name: NF1547_high_7
Description: NF1547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1547_high_7 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 99 - 461
Target Start/End: Complemental strand, 47680969 - 47680604
Alignment:
| Q |
99 |
aaggggaattgctcctcttttgtaagattcgcacatcatatataatatgtatcattaattccaaatataaatgcaataccatatactaccaaatatacat |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
47680969 |
aaggggaattgctcctcttttgtaagattcccacatcata----atatgtatcattaattccaaatataaatgcaataccatatactaccaattatacat |
47680874 |
T |
|
| Q |
199 |
ggatgtacaaagtaatagctacattatacactatcgccaaaaaatccattattgttgtatagtattgatgatcatcaatgaattgagtcaaaccctaata |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47680873 |
ggatgtacaaagtaatagctacattatacactatcgccaaaaaatccattattgttgta--gtattgatgatcatcaatgaattgagtcaaaccctaata |
47680776 |
T |
|
| Q |
299 |
aacgcaattggtttgtgtctcggtttttcaaacatgatgggtggttagggtgtcacaacacaattggtttctgtgtttaaaaattcgaatcctgtctttt |
398 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47680775 |
aacgcaattggtttgtgtctcggtttttcaaacatgatgggtggttagggtgtcacaacacaattggtttctgtgtttaaaaattcgaatcctgtctttt |
47680676 |
T |
|
| Q |
399 |
ccatc---------ctttagggtagccccccatgccttgctgtcactgcatgtaggtccttcattctctgct |
461 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47680675 |
ccatccttgcttttctttagggtagccccccatgccttgctgtcactgcatgtaggtccttcattctctgct |
47680604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University