View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1547_low_23 (Length: 318)
Name: NF1547_low_23
Description: NF1547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1547_low_23 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 79; Significance: 6e-37; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 9 - 139
Target Start/End: Original strand, 17523177 - 17523305
Alignment:
| Q |
9 |
cttgtgctgctttctacttagttctgaataaaaattctatgaactatcatccctaatcttgttctatcttcaattcagacttgaattagaaattatcacc |
108 |
Q |
| |
|
|||||| |||||||||||| ||| ||||| |||| || |||| | ||||||| | ||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
17523177 |
cttgtgatgctttctacttcgtt-tgaattaaaactcgatgatccatcatcc-tcatcttgttctatcttcaattcagacttgaattataaattatcacc |
17523274 |
T |
|
| Q |
109 |
aacttatagtaagtaacttgagttccataaa |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
17523275 |
aacttatagtaagtaacttgagttccataaa |
17523305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 136 - 213
Target Start/End: Original strand, 17524201 - 17524277
Alignment:
| Q |
136 |
taaatatcaacaagatactttagtaacatgtatnnnnnnnnnnttgcacttaactaattttgttaatccctaaattac |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
17524201 |
taaatatcaacaagatactttagtaacatgcataaaaaaaat-ttgcacttaactaattttgttaatccctaaattac |
17524277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 259 - 304
Target Start/End: Original strand, 25052645 - 25052690
Alignment:
| Q |
259 |
tggaatgtgatggagtggtattttgtcacattccattgtttggatt |
304 |
Q |
| |
|
||||||| ||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
25052645 |
tggaatggaatgaagtggtattttgtcacatttcattgtttggatt |
25052690 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University