View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1547_low_26 (Length: 302)
Name: NF1547_low_26
Description: NF1547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1547_low_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 1 - 290
Target Start/End: Original strand, 40719124 - 40719416
Alignment:
| Q |
1 |
ccacctctaattatgtatcaatattttatgaaaccaaaaccttaaatttttcctttttggaattttggtttctttccacgtcacgct---tctacatacg |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
40719124 |
ccacctctaattatgtatcaatattttatgaaaccaaaaccttaaatttttcctttttggaattttggtttctttccacgtcacgctgcttctacatacg |
40719223 |
T |
 |
| Q |
98 |
ttagcgtgcgctcaatacacaccatgtttcgggaacacactcaagtacgtcctccccgttcaaactcacttccacatccgcttttaatgaggcttgatca |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
40719224 |
ttagcgtgcgctcaatacacaccatgtttcgggaacacactcacgtacgtcctccctgttcaaactcactcccacatccgcttttaatgaggcttgatca |
40719323 |
T |
 |
| Q |
198 |
gatcgttcgttttttaaaagttatataatcaaacgaaatatgctatttgtgaagtgttacttcattccatcggattatacattctttcatttt |
290 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40719324 |
gatcgttcgtttttcaaaagttgtataatcaaacgaaatatgctatttgtgaaatgttacttcattccattggattatacattctttcatttt |
40719416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University