View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1547_low_28 (Length: 293)
Name: NF1547_low_28
Description: NF1547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1547_low_28 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 154; Significance: 1e-81; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 1 - 162
Target Start/End: Complemental strand, 8446056 - 8445895
Alignment:
| Q |
1 |
actattttaccctatcttctattaaaatttcaatattaacaagtttcatacgatgtttgtgattacgaggtttcatgtaatgtaataattgcttatttct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
8446056 |
actattttaccctatcttctattaaaatttcaatattaacgagtttcatacgatgtttgtgattacgaggtttcatgtaatgtaataattgcttttttct |
8445957 |
T |
|
| Q |
101 |
aattcagaaagaatgtaataattgttactctttcgtttctttaggtatgtgggttcatttat |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8445956 |
aattcagaaagaatgtaataattgttactctttcgtttctttaggtatgtgggttcatttat |
8445895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 188 - 277
Target Start/End: Complemental strand, 8445899 - 8445810
Alignment:
| Q |
188 |
tttatagcatgactatatgctctataaactgcatttatttggttgttatgaattatatcaatttatttttcgaagttgaaaactaccttt |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
8445899 |
tttatagcatgactatatgctctataaactgcatttatttggttgttatgaattatatcaacttatttttcgaagttgaaaactaccttt |
8445810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 7 - 66
Target Start/End: Complemental strand, 8404417 - 8404358
Alignment:
| Q |
7 |
ttaccctatcttctattaaaatttcaatattaacaagtttcatacgatgtttgtgattac |
66 |
Q |
| |
|
||||||| |||| |||||||||| |||||||| ||||||||||||||||| ||||||| |
|
|
| T |
8404417 |
ttaccctgtcttatattaaaattgtaatattaatgagtttcatacgatgtttatgattac |
8404358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University