View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1547_low_31 (Length: 274)
Name: NF1547_low_31
Description: NF1547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1547_low_31 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 265
Target Start/End: Complemental strand, 14856620 - 14856345
Alignment:
| Q |
1 |
acgcgtttagccactgatgattttgttttgcatgcaaactcttttcgtgatcaat-----------ttgcaacaaatgtacaaagacagtgacaaagctc |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
14856620 |
acgcgtttagccactgatgattttgttttgcatgcaaactcttttcgtgatcaatctttggtttgtttacaacaaatgtacaaagacagtgacaaagctc |
14856521 |
T |
|
| Q |
90 |
gtgaactgaaaatggcacaaattgcaattgatactatgggaaaaggttagtttattcatagattttacttgtttgcatgtgtggttatgctttgtttgaa |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14856520 |
gtgaactgaaaatggcacaaattgcaattgatactatgggaaaaggttagtttattcatagattttacttgtttgcatgtgtggttatgctttgtttgaa |
14856421 |
T |
|
| Q |
190 |
ttatgtcggcttcgattgtgaccaatatttcatcctcataaaatgttaaattagtaatttttaatatcatgatgat |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14856420 |
ttatgtcggcttcgattgtgaccaatatttcatcctcataaaatgttaaattagtaatttttaatatcatgatgat |
14856345 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University