View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1547_low_47 (Length: 238)
Name: NF1547_low_47
Description: NF1547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1547_low_47 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 17 - 238
Target Start/End: Original strand, 13129074 - 13129295
Alignment:
| Q |
17 |
aagatgtgcccctctattattccaatttcaaatggtcactgtgtttgctcattttgaatcacaaatgagaagtatagatccaaattatttcagcacctgt |
116 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13129074 |
aagatttgcccctctattattccaatttcaaatggtcactatgtttgctcattttgaaccacaaatgagaagtatagatccaaattatttcagcacctgt |
13129173 |
T |
 |
| Q |
117 |
gacttcttttctaatgtggaaaccaaacttgatcgaatcatatcagaccagactttgctcaaaccaaatctttccaaactttagacccgtgccagaccaa |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
13129174 |
gacttcttttctaatgtggaaaccaaacttgatcgaatcatatcagaccagactttgctcaaaccaaatctttccaaactttagatccgtgccagaccaa |
13129273 |
T |
 |
| Q |
217 |
aagtcatgaatatgatttggtt |
238 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
13129274 |
aagtcatgaatatgatttggtt |
13129295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 95 - 161
Target Start/End: Original strand, 40508417 - 40508483
Alignment:
| Q |
95 |
tccaaattatttcagcacctgtgacttcttttctaatgtggaaaccaaacttgatcgaatcatatca |
161 |
Q |
| |
|
||||| ||||| |||||||||||| |||||||| || || ||||| ||||| |||||||||||||| |
|
|
| T |
40508417 |
tccaatttattgcagcacctgtgatttcttttccaaagtagaaactaaactgaatcgaatcatatca |
40508483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University