View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1547_low_51 (Length: 238)
Name: NF1547_low_51
Description: NF1547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1547_low_51 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 18 - 230
Target Start/End: Original strand, 48255280 - 48255492
Alignment:
| Q |
18 |
gtttataataagatcctattgattgtagatatggactcaaaaatggaattccaatagcttgagctgccagaatcaaataaataaaaatgtttgattgttt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
48255280 |
gtttataataagatcctattgattgtagatatggactcaaaaatggaattccaatagcttgagctgccagaatcaaataaatataaatgtttgattgttt |
48255379 |
T |
|
| Q |
118 |
aataaattatatatagctctcaaccattaaattatgtctctaatcatggtgaatgacatcacataccaagatatacagagacagcagttgatagagttaa |
217 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
48255380 |
aataaatgatatatagctctcaaccattaaattatgtctctaatcatggtgaatgacatcacataccaagatatacagagatagcagttgatagagttaa |
48255479 |
T |
|
| Q |
218 |
tatttattttctt |
230 |
Q |
| |
|
||||||||||||| |
|
|
| T |
48255480 |
tatttattttctt |
48255492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University