View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1547_low_53 (Length: 237)
Name: NF1547_low_53
Description: NF1547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1547_low_53 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 10470105 - 10469884
Alignment:
| Q |
1 |
tatctagatgctagagaaccatatggtctggtctcccaaatgggaagaccgccatttcaaagattcactccacaccacctataaaattgaccaattaaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
10470105 |
tatctagatgctagagaaccatatggtcgggtctcccaaatgggaagaccgccatttcaaagattcactccacaccacttataaaattgaacaattaaag |
10470006 |
T |
|
| Q |
101 |
aagatgatttaggatttctagatttcaacaataagatgaagaattgatattga-nnnnnnnnncttcctaaagttatcatttgtttgaaggagtgaatag |
199 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10470005 |
aagatgatttaggatttctagatttccacaataagatgaagaattgatattgattttttttttcttcctaaagttatcatttgtttgaaggagtgaatag |
10469906 |
T |
|
| Q |
200 |
ccaatcacctccttgaatttgt |
221 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
10469905 |
ccaatcacctccttgaatttgt |
10469884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University