View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1547_low_55 (Length: 233)
Name: NF1547_low_55
Description: NF1547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1547_low_55 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 14 - 217
Target Start/End: Complemental strand, 43175466 - 43175266
Alignment:
| Q |
14 |
ataattctgtattctactctattcaatgcatcttcatctaccactcatgatagcattgaacatgtcgtcaacaacgatggcggtggtcagtggttagaat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43175466 |
ataattctgtattctactctattcaatgcatcttcaacaaccactcatgatagcattgaacatgtcgtcaacaacgatggcggtggtcagtggttagaat |
43175367 |
T |
 |
| Q |
114 |
acaatgcaatagaatcagagaatgattctgaaaatgttacagaaagtgaatccgccaaaaaggaagaagaaaagatgttgattatatcttatgagccaga |
213 |
Q |
| |
|
||| |||| ||||| | ||||||| |||||||||||||||||||||||| | | ||| || || ||||| | ||||| ||||||||||||||||| |
|
|
| T |
43175366 |
acattgcatccgaatctgcgaatgatgctgaaaatgttacagaaagtgaat---caacaaaagaggaggaaaaaactttgatgatatcttatgagccaga |
43175270 |
T |
 |
| Q |
214 |
taaa |
217 |
Q |
| |
|
|||| |
|
|
| T |
43175269 |
taaa |
43175266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University