View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1547_low_62 (Length: 211)
Name: NF1547_low_62
Description: NF1547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1547_low_62 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 15 - 193
Target Start/End: Original strand, 7631354 - 7631532
Alignment:
| Q |
15 |
cataggttattctattactttgcttttgagttctatgataaaaaccgttaaaccagagttcttatataatgtatgaaatttgatccatctctgaatgtac |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7631354 |
cataggttattctattactttgcttttgagttctatgataaaaaccgttaaatcatagttcttatataatgtatgaaatttgatccatctctgaatgtac |
7631453 |
T |
 |
| Q |
115 |
atccaatggattatttgatccatattgatgcaatgcggccagatgaagactggcgcctactaaaacaaaggggagtacc |
193 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
7631454 |
acccaatggattatttgatccatattgatgcaatgcggccagatgaagattggcgcctactaaaacaaaggggagtacc |
7631532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University