View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1547_low_63 (Length: 208)
Name: NF1547_low_63
Description: NF1547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1547_low_63 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 21 - 186
Target Start/End: Complemental strand, 11480703 - 11480538
Alignment:
| Q |
21 |
ccaagtgaataagagattaagagagaggaaagttgtgatgcctctactcagttcaaacgaacaacccttcttcgttgactgataatagccaagtgaataa |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11480703 |
ccaagtgaataagagattaagagagaggaaagttgtgatgcctctactcagttcaaacgaacaacccttcttcgttgactgataatagccaagtgaataa |
11480604 |
T |
 |
| Q |
121 |
aagcttaagatagactagggtttcttttcagttacagattcagaaaggtgctatgatattcaacgt |
186 |
Q |
| |
|
||||||| | |||||| |||||||||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
11480603 |
aagcttataagagactaaggtttcttttcaattacagattctgaaaggtgctatgatattcaacgt |
11480538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 53 - 130
Target Start/End: Complemental strand, 11480759 - 11480682
Alignment:
| Q |
53 |
ttgtgatgcctctactcagttcaaacgaacaacccttcttcgttgactgataatagccaagtgaataaaagcttaaga |
130 |
Q |
| |
|
|||||||||||||||| |||||| |||||||| | |||| ||||||||||||| |||||||||||||| || |||||| |
|
|
| T |
11480759 |
ttgtgatgcctctacttagttcacacgaacaaacattctccgttgactgataacagccaagtgaataagagattaaga |
11480682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University