View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1548-INSERTION-1 (Length: 98)
Name: NF1548-INSERTION-1
Description: NF1548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1548-INSERTION-1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 55; Significance: 4e-23; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 55; E-Value: 4e-23
Query Start/End: Original strand, 7 - 61
Target Start/End: Complemental strand, 25296070 - 25296016
Alignment:
| Q |
7 |
agttccggcaagaatggtcactgatttgttcggtgcgtttcttttttattttctt |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25296070 |
agttccggcaagaatggtcactgatttgttcggtgcgtttcttttttattttctt |
25296016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University