View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15481_high_19 (Length: 340)
Name: NF15481_high_19
Description: NF15481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15481_high_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 20 - 327
Target Start/End: Original strand, 53381877 - 53382184
Alignment:
| Q |
20 |
catatcagtttcaagcacaagctcctcggaaatgataagggacacgggaatctctatagcaatatctccaacttttagatctttccctgctatcattccc |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53381877 |
catatcagtttcaagcacaagctcctcggaaatgataagggacacgggaatctctatagcaatatctccaacttttagatctttccctgctatcattcca |
53381976 |
T |
|
| Q |
120 |
cgacctgctccttcaacatctgtgtagattaaggggagaagaaatctgtattacacatcttaaagataatacctgtgcaaaggaaaggaaattgttctca |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53381977 |
cgacctgctccttcaacatctgtgtagattaaggggagaagaaatctgtatcacacatcttaaagataatacctgtgcaaaggaaaggaaattgttctca |
53382076 |
T |
|
| Q |
220 |
aatgagacagcaattgaaaagacacaaaattacgatgaaacccacaagctatctttaatcctgtctttacgccatggcttttaccccactcgatcaggtg |
319 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53382077 |
aatgagaaagcaattgaaaagacacaaaattacgatgaaacccacaagctatctttaatcctgtctttacgccatggcttttaccccactcgatcaggtg |
53382176 |
T |
|
| Q |
320 |
ttcatctc |
327 |
Q |
| |
|
||| |||| |
|
|
| T |
53382177 |
ttcttctc |
53382184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University