View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15481_high_31 (Length: 274)
Name: NF15481_high_31
Description: NF15481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15481_high_31 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 1 - 255
Target Start/End: Original strand, 34372152 - 34372406
Alignment:
| Q |
1 |
ggtgtgtaaagatgcatgatgttgtgcgtgatgttgtcctaaaaatttcatccagagaagaacttgggattttggtgcagtttaatgtagaattaaagag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34372152 |
ggtgtgtaaagatgcatgatgttgtgcgtgatgttgtcctaaaaatttcatccagagaagaacttgggattttggtgcagtttaatgtagaattaaagag |
34372251 |
T |
|
| Q |
101 |
ggtgaaaaagaaactaacaaaatggcgtaggatgtcccttattttggacgaggatattgagttagaaaatggcctagaatgtccaactctagagctttta |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34372252 |
ggtgaaaaagaaactagcaaaatggcgtaggatgtcccttattttggacgaggatattgagttagaaaatggcctagaatgtccaactctagagctttta |
34372351 |
T |
|
| Q |
201 |
caggttctatgtcaaagagaaaatagagaagtgaatatatggccagagaacttta |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34372352 |
caggttctatgtcaaagagaaaatagagaagtgaatatatggccagagaacttta |
34372406 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University