View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15481_high_34 (Length: 253)
Name: NF15481_high_34
Description: NF15481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15481_high_34 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 119; Significance: 7e-61; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 1 - 119
Target Start/End: Complemental strand, 42369513 - 42369395
Alignment:
| Q |
1 |
atgttatcacttgaatctaatcccatcatgatcttcttcagaccagaatggttttctggagctgacagttgcaataggcaaaaagggttttcttgaatga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42369513 |
atgttatcacttgaatctaatcccatcatgatcttcttcagaccagaatggttttctggagctgacagttgcaataggcaaaaagggttttcttgaatga |
42369414 |
T |
|
| Q |
101 |
atcaaacaatcaaaattag |
119 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
42369413 |
atcaaacaatcaaaattag |
42369395 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 185 - 235
Target Start/End: Complemental strand, 42369330 - 42369280
Alignment:
| Q |
185 |
caaaagacaagaacatgtgagatttgtttggtaggattgattgatagtttc |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42369330 |
caaaagacaagaacatgtgagatttgtttggtaggattgattgatagtttc |
42369280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University