View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15481_high_37 (Length: 250)
Name: NF15481_high_37
Description: NF15481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15481_high_37 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 15 - 243
Target Start/End: Complemental strand, 28857374 - 28857146
Alignment:
| Q |
15 |
atatgttccaacaggaacaccacaactcaatactcgtacacaactggattcaatggtggttagtttccaacaacacgaatgatgcttccactatgtcgtt |
114 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28857374 |
atatgttcctacaggaacaccacaactcaatactcgtacacaactggattcaatggtggttagtttccaacaacacgaatgatgcttccactatgtcgtt |
28857275 |
T |
|
| Q |
115 |
gtgagttgccaatgccaatggttgtttacattgccaacacaaatgagaatcaaggccagaggttttggagatgtcatggttggcaagcgagtttttcttg |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
28857274 |
gtgagttgccaatgccaatggttgtttacattggcaacacaaatgagaatcaaggccagaggttttggagatgtcatgattggcaagcgagtttttcttg |
28857175 |
T |
|
| Q |
215 |
atttgaaattgagttgtccctgtgatttt |
243 |
Q |
| |
|
||||||||||||||||||||| ||||||| |
|
|
| T |
28857174 |
atttgaaattgagttgtccctctgatttt |
28857146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 60 - 201
Target Start/End: Complemental strand, 28247932 - 28247792
Alignment:
| Q |
60 |
ggattcaatggtggttagtttccaacaacacgaatgatgcttccactatgtcgttgtgagttgccaatgccaatggttgtttacattgccaacacaaatg |
159 |
Q |
| |
|
|||||||||||||||| ||||| || ||||| |||| ||||||| || ||||||||||| ||| ||||||||||||||||| || | |||| | |
|
|
| T |
28247932 |
ggattcaatggtggttcgtttcttact-cacgagggatgtttccactgtgccgttgtgagttttcaaggccaatggttgtttacaaagctagcacattgg |
28247834 |
T |
|
| Q |
160 |
agaatcaaggccagaggttttggagatgtcatggttggcaag |
201 |
Q |
| |
|
||||||||||||| |||||||||||||||| || |||||||| |
|
|
| T |
28247833 |
agaatcaaggccaaaggttttggagatgtcgtgattggcaag |
28247792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University