View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15481_high_39 (Length: 224)
Name: NF15481_high_39
Description: NF15481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15481_high_39 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 55; Significance: 9e-23; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 13 - 71
Target Start/End: Original strand, 26948959 - 26949017
Alignment:
| Q |
13 |
attatactaatagaaaaatattcatagcttgacaattacacccatttaatgatatttat |
71 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26948959 |
attacactaatagaaaaatattcatagcttgacaattacacccatttaatgatatttat |
26949017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 164 - 205
Target Start/End: Original strand, 26949035 - 26949076
Alignment:
| Q |
164 |
tgcaatttgtgatgcatgaatagggatttgttgtagtagatg |
205 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26949035 |
tgcactttgtgatgcatgaatagggatttgttgtagtagatg |
26949076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University