View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15481_low_18 (Length: 350)
Name: NF15481_low_18
Description: NF15481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15481_low_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 137; Significance: 2e-71; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 1 - 160
Target Start/End: Original strand, 43208152 - 43208314
Alignment:
| Q |
1 |
atgtaatatattgatgatgtgataa---cagagaaatagagagaatgtaaagtgttgcgtatatgtataaaaaggtcgggtgtttaagtataacaattgt |
97 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43208152 |
atgtaatatattgataatgtgataatagcagagaaatagagagaatgtaaagtgttgcatatgtgtataaaaaggtcgggtgtttaagtataacaattgt |
43208251 |
T |
|
| Q |
98 |
ttctgttttagtaggtttcatattttattatccttcttacaattattattcgtcatgataagg |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43208252 |
ttctgttttagtaggtttcatattttattatccttcttacaattattattcgtcatgataagg |
43208314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 237 - 334
Target Start/End: Original strand, 43208391 - 43208488
Alignment:
| Q |
237 |
ttgtggacattagataggttagttgatagcggataaaattagaaactaatagattgtttagggttagtagagaagcttcaccttctgataaaagaggt |
334 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
43208391 |
ttgtggacattagataggttagttgatagctgataaaattagaaattaatagattgtttagggttagttgagaagcttcaccttctgataaaagaggt |
43208488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University