View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15481_low_27 (Length: 323)
Name: NF15481_low_27
Description: NF15481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15481_low_27 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 234 - 305
Target Start/End: Original strand, 42369747 - 42369818
Alignment:
| Q |
234 |
ttatgttatgatattagggactttatggacagcagtggcacacatagtgacaggggtgataggatcaggagt |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
42369747 |
ttatgttatgatattagggactttatggacagcagtagcacacatagtgacaggggtgataggatcaggagt |
42369818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 1 - 69
Target Start/End: Original strand, 42369521 - 42369589
Alignment:
| Q |
1 |
cctttgtttctcactcaatctcaatctcatcctatcaaaagaacaggtttctcttctcaattcttcatc |
69 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42369521 |
cctttgttactcactcaatctcaatctcatcctatcaaaagaacaggtttctcttctcaattcttcatc |
42369589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 257 - 305
Target Start/End: Original strand, 24429822 - 24429870
Alignment:
| Q |
257 |
tatggacagcagtggcacacatagtgacaggggtgataggatcaggagt |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
24429822 |
tatggacagcagtggcacacatagtgacaggagtaataggatcaggagt |
24429870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University