View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15481_low_27 (Length: 323)

Name: NF15481_low_27
Description: NF15481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15481_low_27
NF15481_low_27
[»] chr5 (2 HSPs)
chr5 (234-305)||(42369747-42369818)
chr5 (1-69)||(42369521-42369589)
[»] chr3 (1 HSPs)
chr3 (257-305)||(24429822-24429870)


Alignment Details
Target: chr5 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 234 - 305
Target Start/End: Original strand, 42369747 - 42369818
Alignment:
234 ttatgttatgatattagggactttatggacagcagtggcacacatagtgacaggggtgataggatcaggagt 305  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
42369747 ttatgttatgatattagggactttatggacagcagtagcacacatagtgacaggggtgataggatcaggagt 42369818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 1 - 69
Target Start/End: Original strand, 42369521 - 42369589
Alignment:
1 cctttgtttctcactcaatctcaatctcatcctatcaaaagaacaggtttctcttctcaattcttcatc 69  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42369521 cctttgttactcactcaatctcaatctcatcctatcaaaagaacaggtttctcttctcaattcttcatc 42369589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 257 - 305
Target Start/End: Original strand, 24429822 - 24429870
Alignment:
257 tatggacagcagtggcacacatagtgacaggggtgataggatcaggagt 305  Q
    ||||||||||||||||||||||||||||||| || ||||||||||||||    
24429822 tatggacagcagtggcacacatagtgacaggagtaataggatcaggagt 24429870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University