View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15481_low_28 (Length: 307)
Name: NF15481_low_28
Description: NF15481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15481_low_28 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 18 - 276
Target Start/End: Original strand, 5562904 - 5563163
Alignment:
| Q |
18 |
gttgttgactcttcaggttcattcttcgttcgacttacgctgtatctttctcatattcaaatgcgttgcgtttatgctttgtgattatgnnnnnnnnnct |
117 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
5562904 |
gttgttgactcctcaggttcattcttcgttcgactaacgctgtatctttctcatattcaaatgcgttgcgtttatgctttgtgattatgtgttttttttt |
5563003 |
T |
|
| Q |
118 |
t-cagggattgagaaagtagtgagcaccattgattctattccgaaagttgaatgggattttgaagggattcattattttgataatggtcctctcactgtt |
216 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5563004 |
ttcagggattgagaaagtagtgagcaccattgattctattccgaaagttgaatgggattttgaagggattcattattttgataatggtcctctcactgtt |
5563103 |
T |
|
| Q |
217 |
cagtacttgtttgttttggatgctttgaacttttgcttctggcctggtacgtatgtagta |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5563104 |
cagtacttgtttgttttggatgctttgaacttttgcttctggcctggtacgtatgtagta |
5563163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University