View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15481_low_32 (Length: 280)
Name: NF15481_low_32
Description: NF15481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15481_low_32 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 20 - 269
Target Start/End: Original strand, 9166913 - 9167171
Alignment:
| Q |
20 |
ttcatgacaaatgttatcatcttttcatgtccacagcaatcatcaactaaacaactcagtattttgacctaaccttaccaagacacggtgtattcagtat |
119 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9166913 |
ttcatgacaaatattatcatcttttcatgtccacagcaatcatcaactaaacaactcagtattttgacctaaccttaccaagacacggtgtattcagtat |
9167012 |
T |
 |
| Q |
120 |
cgcactatgaataaaatacaatccgcttatccac--gg------tgt-attcatcttttatttatacatatgaacatacgaaataagaaagtattaaagg |
210 |
Q |
| |
|
|| ||||||||||||||||||| | ||||||||| || ||| || |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9167013 |
cgtactatgaataaaatacaatgcacttatccacatggcaccattgtcatatatcttttatttatacatatgaacatacgaaataagaaagtattaaagg |
9167112 |
T |
 |
| Q |
211 |
ttcacaacttcaatgagagcannnnnnnaattaaaatgttgtgttttcaagcagttctt |
269 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
9167113 |
ttcacaacttcaatgagagcatatttttaattaaaatgttgtgttttcaagcagttctt |
9167171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 39 - 104
Target Start/End: Original strand, 9155517 - 9155582
Alignment:
| Q |
39 |
tcttttcatgtccacagcaatcatcaactaaacaactcagtattttgacctaaccttaccaagaca |
104 |
Q |
| |
|
|||||||||||||||| |||||||||| ||||||||||| |||||||||| ||| |||||| |||| |
|
|
| T |
9155517 |
tcttttcatgtccacaacaatcatcaattaaacaactcaatattttgacccaacattaccatgaca |
9155582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University