View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15481_low_37 (Length: 252)
Name: NF15481_low_37
Description: NF15481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15481_low_37 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 136; Significance: 5e-71; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 54 - 230
Target Start/End: Original strand, 34507704 - 34507882
Alignment:
| Q |
54 |
atttgattcaatttctaatccaacacagttctgtttatagtgcattggtgtcta--accaagtgaattatttatgttttttgactataataattgaattc |
151 |
Q |
| |
|
|||||||||| |||||||||||||| || |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
34507704 |
atttgattcactttctaatccaacagagacctgtttatagtgcattggtgtctactaccaagtgaattatttatgttttttgactataaaaattgaattc |
34507803 |
T |
 |
| Q |
152 |
aaatctaacaaacacaaacaaagcagaagattagacaaaatgaggccaaaatgaataattcttttaccaaccatcttaa |
230 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
34507804 |
aaatctaacaagcacaaacaaagcagaagattagacaaaatgaggccaaaatgaataattcttataccaaccatgttaa |
34507882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 1 - 34
Target Start/End: Original strand, 34507652 - 34507685
Alignment:
| Q |
1 |
tctaaagagtagctatgaatgtttttaagttgaa |
34 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
34507652 |
tctaaagagtagttatgaatgtttttaagttgaa |
34507685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University